Incidental Mutation 'R6854:Olfr187'
ID535165
Institutional Source Beutler Lab
Gene Symbol Olfr187
Ensembl Gene ENSMUSG00000043357
Gene Nameolfactory receptor 187
SynonymsGA_x54KRFPKG5P-55265713-55264787, MOR183-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59035563-59039767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59036065 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 224 (I224S)
Ref Sequence ENSEMBL: ENSMUSP00000147035 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206428
AA Change: I224S

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207673
AA Change: I224S

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Olfr187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Olfr187 APN 16 59035906 missense probably damaging 1.00
R0218:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R1023:Olfr187 UTSW 16 59035815 missense probably benign 0.00
R1086:Olfr187 UTSW 16 59036263 missense probably damaging 1.00
R1472:Olfr187 UTSW 16 59036557 missense probably damaging 1.00
R4710:Olfr187 UTSW 16 59036275 missense possibly damaging 0.94
R4738:Olfr187 UTSW 16 59036195 missense probably benign 0.00
R5265:Olfr187 UTSW 16 59036143 missense possibly damaging 0.94
R6053:Olfr187 UTSW 16 59035988 missense probably damaging 1.00
R6704:Olfr187 UTSW 16 59035862 missense probably damaging 1.00
R7178:Olfr187 UTSW 16 59035933 missense probably benign 0.06
R7198:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R7404:Olfr187 UTSW 16 59036240 missense possibly damaging 0.81
R7462:Olfr187 UTSW 16 59036016 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCAAATGTAACAGAGAGTTGC -3'
(R):5'- CTACCCAGTAGTTATGACCAATGG -3'

Sequencing Primer
(F):5'- TTGCCAGTGAATCTATAACTTGC -3'
(R):5'- GCTGGAATTATTCATGCTTTGATTC -3'
Posted On2018-09-12