Incidental Mutation 'R6854:Speer2'
ID535166
Institutional Source Beutler Lab
Gene Symbol Speer2
Ensembl Gene ENSMUSG00000063163
Gene Namespermatogenesis associated glutamate (E)-rich protein 2
SynonymsSPEER-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location69856874-69863744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69858887 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 106 (Q106L)
Ref Sequence ENSEMBL: ENSMUSP00000075821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000166256]
Predicted Effect probably damaging
Transcript: ENSMUST00000076500
AA Change: Q106L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163
AA Change: Q106L

DomainStartEndE-ValueType
Pfam:Takusan 51 137 6.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166256
AA Change: Q17L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163
AA Change: Q17L

DomainStartEndE-ValueType
Pfam:Takusan 1 49 2.3e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Speer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Speer2 APN 16 69860518 missense probably benign 0.01
IGL01115:Speer2 APN 16 69861651 nonsense probably null
IGL01694:Speer2 APN 16 69858112 missense probably damaging 0.98
IGL01694:Speer2 APN 16 69858113 missense probably damaging 1.00
IGL02738:Speer2 APN 16 69861712 missense probably benign
IGL03024:Speer2 APN 16 69858115 missense possibly damaging 0.95
IGL03062:Speer2 APN 16 69857977 missense probably damaging 0.96
R0054:Speer2 UTSW 16 69858752 missense probably damaging 0.99
R1248:Speer2 UTSW 16 69857067 unclassified probably null
R1952:Speer2 UTSW 16 69857164 missense probably damaging 0.96
R1993:Speer2 UTSW 16 69858077 missense probably benign 0.01
R1995:Speer2 UTSW 16 69858077 missense probably benign 0.01
R2063:Speer2 UTSW 16 69860497 missense probably benign 0.02
R2155:Speer2 UTSW 16 69860597 missense possibly damaging 0.63
R2216:Speer2 UTSW 16 69858842 missense possibly damaging 0.94
R4547:Speer2 UTSW 16 69858849 missense probably damaging 0.98
R4548:Speer2 UTSW 16 69858849 missense probably damaging 0.98
R4625:Speer2 UTSW 16 69858754 nonsense probably null
R4692:Speer2 UTSW 16 69857972 missense possibly damaging 0.91
R4841:Speer2 UTSW 16 69858100 missense probably benign 0.26
R4842:Speer2 UTSW 16 69858100 missense probably benign 0.26
R5035:Speer2 UTSW 16 69857941 critical splice donor site probably null
R5133:Speer2 UTSW 16 69858820 missense probably null 0.06
R5812:Speer2 UTSW 16 69858895 missense possibly damaging 0.82
R6348:Speer2 UTSW 16 69858007 missense possibly damaging 0.83
R7446:Speer2 UTSW 16 69858077 missense possibly damaging 0.82
R8068:Speer2 UTSW 16 69860524 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCATTCCACTGTTGATTGGC -3'
(R):5'- TCCAACCCTACTGCGTGAAC -3'

Sequencing Primer
(F):5'- GCTTGCTAACTGGTACTTACGTATAG -3'
(R):5'- CCTACTGCGTGAACACAGG -3'
Posted On2018-09-12