Incidental Mutation 'R6855:Rnf38'
ID535184
Institutional Source Beutler Lab
Gene Symbol Rnf38
Ensembl Gene ENSMUSG00000035696
Gene Namering finger protein 38
Synonyms2610202O07Rik, Oip1, 1700065B19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R6855 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location44126210-44233789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44149224 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 41 (R41H)
Ref Sequence ENSEMBL: ENSMUSP00000116642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045793] [ENSMUST00000098098] [ENSMUST00000102934] [ENSMUST00000107836] [ENSMUST00000128426] [ENSMUST00000136730] [ENSMUST00000143337] [ENSMUST00000145760]
Predicted Effect probably damaging
Transcript: ENSMUST00000045793
AA Change: R41H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038477
Gene: ENSMUSG00000035696
AA Change: R41H

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098098
AA Change: R73H

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095702
Gene: ENSMUSG00000035696
AA Change: R73H

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 319 342 N/A INTRINSIC
RING 412 452 9.09e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102934
AA Change: R41H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099998
Gene: ENSMUSG00000035696
AA Change: R41H

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107836
AA Change: R41H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103467
Gene: ENSMUSG00000035696
AA Change: R41H

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128426
AA Change: R41H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119889
Gene: ENSMUSG00000035696
AA Change: R41H

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136730
AA Change: R41H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116642
Gene: ENSMUSG00000035696
AA Change: R41H

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143337
AA Change: R41H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122342
Gene: ENSMUSG00000035696
AA Change: R41H

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145760
AA Change: R41H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121329
Gene: ENSMUSG00000035696
AA Change: R41H

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 202 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a coiled-coil motif and a RING-H2 motif (C3H2C2) at its carboxy-terminus. The RING motif is a zinc-binding domain found in a large set of proteins playing roles in diverse cellular processes including oncogenesis, development, signal transduction, and apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,114,845 S228F probably damaging Het
Cdh23 A T 10: 60,306,122 M3062K possibly damaging Het
Cdh8 G C 8: 99,190,217 S422C probably damaging Het
Col15a1 G T 4: 47,245,544 K98N probably damaging Het
Cyp3a57 T A 5: 145,372,566 L238H probably damaging Het
Dchs2 G A 3: 83,348,194 R2399H probably benign Het
Dennd4c A C 4: 86,836,457 H1568P probably benign Het
Dkk2 T G 3: 132,177,922 C194W probably damaging Het
Dnm2 C T 9: 21,476,585 R369C probably damaging Het
Efcab7 T G 4: 99,900,580 L308* probably null Het
Elp2 T A 18: 24,606,877 N53K possibly damaging Het
Eml6 T C 11: 29,751,381 probably null Het
Erich3 G T 3: 154,762,649 E913* probably null Het
Fam159b T C 13: 104,863,706 Q3R probably benign Het
Fam186a T A 15: 99,954,875 Y154F unknown Het
Fhl3 G A 4: 124,707,522 D113N probably benign Het
Fryl A T 5: 73,059,500 M2149K probably damaging Het
Gbf1 T C 19: 46,279,941 Y1251H probably benign Het
Ghitm C A 14: 37,125,902 G262W probably null Het
Gm14325 T A 2: 177,832,842 H148L probably damaging Het
Grxcr1 C A 5: 68,032,094 N69K possibly damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdelc1 C A 1: 44,110,827 E401* probably null Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrp1b G C 2: 40,628,696 H175D possibly damaging Het
Lrrc2 T A 9: 110,953,182 probably null Het
Mpp3 A G 11: 102,013,325 F291L probably benign Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Nfil3 T A 13: 52,968,605 K88* probably null Het
Nit1 A C 1: 171,343,562 V194G probably damaging Het
Nup210 T C 6: 91,040,853 M1052V probably benign Het
Nup210l A G 3: 90,136,924 T511A probably benign Het
Nwd2 G T 5: 63,804,451 M459I probably benign Het
Olfr1077-ps1 T C 2: 86,526,169 N3D probably benign Het
Peg3 A C 7: 6,708,798 S1142A probably benign Het
Phf3 T A 1: 30,820,123 K959N probably damaging Het
Piezo2 C T 18: 63,090,879 probably null Het
Pigz A G 16: 31,945,218 I365V possibly damaging Het
Plec T A 15: 76,186,618 Q860L probably damaging Het
Ppp5c T G 7: 17,006,966 D359A possibly damaging Het
Pvr C T 7: 19,909,214 A365T possibly damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rasa3 A T 8: 13,585,029 L430Q probably damaging Het
Rims2 T G 15: 39,345,515 V198G probably benign Het
Rptn G A 3: 93,398,251 V964I probably benign Het
Rrp1b A G 17: 32,052,745 D263G probably benign Het
Sgip1 T C 4: 102,962,376 C560R probably damaging Het
Sidt1 A C 16: 44,245,343 I734S probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Ssh1 G T 5: 113,942,575 D931E probably damaging Het
Thumpd2 C A 17: 81,044,170 R274I probably damaging Het
Tpi1 T C 6: 124,812,463 D183G probably damaging Het
Trnt1 T A 6: 106,777,922 Y205N probably damaging Het
Tsc22d2 G A 3: 58,416,814 V376M probably damaging Het
Usp34 T C 11: 23,452,569 V2454A possibly damaging Het
Uspl1 C A 5: 149,187,845 S24Y probably damaging Het
Vmn1r58 A C 7: 5,410,452 W260G possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zfp868 A C 8: 69,611,579 H368Q probably damaging Het
Other mutations in Rnf38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Rnf38 APN 4 44137645 missense probably benign 0.09
IGL01992:Rnf38 APN 4 44138806 missense probably damaging 1.00
IGL02682:Rnf38 APN 4 44133745 missense probably damaging 1.00
IGL02951:Rnf38 APN 4 44129619 nonsense probably null
IGL03032:Rnf38 APN 4 44152529 missense probably damaging 0.99
IGL03326:Rnf38 APN 4 44149182 missense probably benign 0.27
R0335:Rnf38 UTSW 4 44152507 missense possibly damaging 0.59
R0336:Rnf38 UTSW 4 44152350 splice site probably benign
R1473:Rnf38 UTSW 4 44131584 missense probably benign 0.00
R1552:Rnf38 UTSW 4 44142468 splice site probably null
R1670:Rnf38 UTSW 4 44138681 missense probably damaging 0.96
R1708:Rnf38 UTSW 4 44143593 missense probably damaging 1.00
R1943:Rnf38 UTSW 4 44138748 missense probably damaging 0.99
R2063:Rnf38 UTSW 4 44149098 missense probably damaging 0.99
R4348:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4352:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4353:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4618:Rnf38 UTSW 4 44142450 missense probably damaging 1.00
R4967:Rnf38 UTSW 4 44152460 missense probably damaging 1.00
R5230:Rnf38 UTSW 4 44149176 missense probably benign 0.17
R6275:Rnf38 UTSW 4 44152408 missense probably benign 0.11
R7200:Rnf38 UTSW 4 44137620 missense probably benign 0.01
R7326:Rnf38 UTSW 4 44158989 intron probably benign
R7351:Rnf38 UTSW 4 44149102 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ATGACTGCATTCTGCTGGGG -3'
(R):5'- TGGTCAACAACTAAGTGACTAGAG -3'

Sequencing Primer
(F):5'- GGGGATGGGCAGCTGGATG -3'
(R):5'- GTGTGCTCTTTCATACACAC -3'
Posted On2018-09-12