Incidental Mutation 'R6855:Nwd2'
ID535189
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6855 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63804451 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 459 (M459I)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584] [ENSMUST00000162166]
Predicted Effect probably benign
Transcript: ENSMUST00000159584
AA Change: M459I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: M459I

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162166
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,114,845 S228F probably damaging Het
Cdh23 A T 10: 60,306,122 M3062K possibly damaging Het
Cdh8 G C 8: 99,190,217 S422C probably damaging Het
Col15a1 G T 4: 47,245,544 K98N probably damaging Het
Cyp3a57 T A 5: 145,372,566 L238H probably damaging Het
Dchs2 G A 3: 83,348,194 R2399H probably benign Het
Dennd4c A C 4: 86,836,457 H1568P probably benign Het
Dkk2 T G 3: 132,177,922 C194W probably damaging Het
Dnm2 C T 9: 21,476,585 R369C probably damaging Het
Efcab7 T G 4: 99,900,580 L308* probably null Het
Elp2 T A 18: 24,606,877 N53K possibly damaging Het
Eml6 T C 11: 29,751,381 probably null Het
Erich3 G T 3: 154,762,649 E913* probably null Het
Fam159b T C 13: 104,863,706 Q3R probably benign Het
Fam186a T A 15: 99,954,875 Y154F unknown Het
Fhl3 G A 4: 124,707,522 D113N probably benign Het
Fryl A T 5: 73,059,500 M2149K probably damaging Het
Gbf1 T C 19: 46,279,941 Y1251H probably benign Het
Ghitm C A 14: 37,125,902 G262W probably null Het
Gm14325 T A 2: 177,832,842 H148L probably damaging Het
Grxcr1 C A 5: 68,032,094 N69K possibly damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdelc1 C A 1: 44,110,827 E401* probably null Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrp1b G C 2: 40,628,696 H175D possibly damaging Het
Lrrc2 T A 9: 110,953,182 probably null Het
Mpp3 A G 11: 102,013,325 F291L probably benign Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Nfil3 T A 13: 52,968,605 K88* probably null Het
Nit1 A C 1: 171,343,562 V194G probably damaging Het
Nup210 T C 6: 91,040,853 M1052V probably benign Het
Nup210l A G 3: 90,136,924 T511A probably benign Het
Olfr1077-ps1 T C 2: 86,526,169 N3D probably benign Het
Peg3 A C 7: 6,708,798 S1142A probably benign Het
Phf3 T A 1: 30,820,123 K959N probably damaging Het
Piezo2 C T 18: 63,090,879 probably null Het
Pigz A G 16: 31,945,218 I365V possibly damaging Het
Plec T A 15: 76,186,618 Q860L probably damaging Het
Ppp5c T G 7: 17,006,966 D359A possibly damaging Het
Pvr C T 7: 19,909,214 A365T possibly damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rasa3 A T 8: 13,585,029 L430Q probably damaging Het
Rims2 T G 15: 39,345,515 V198G probably benign Het
Rnf38 C T 4: 44,149,224 R41H probably damaging Het
Rptn G A 3: 93,398,251 V964I probably benign Het
Rrp1b A G 17: 32,052,745 D263G probably benign Het
Sgip1 T C 4: 102,962,376 C560R probably damaging Het
Sidt1 A C 16: 44,245,343 I734S probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Ssh1 G T 5: 113,942,575 D931E probably damaging Het
Thumpd2 C A 17: 81,044,170 R274I probably damaging Het
Tpi1 T C 6: 124,812,463 D183G probably damaging Het
Trnt1 T A 6: 106,777,922 Y205N probably damaging Het
Tsc22d2 G A 3: 58,416,814 V376M probably damaging Het
Usp34 T C 11: 23,452,569 V2454A possibly damaging Het
Uspl1 C A 5: 149,187,845 S24Y probably damaging Het
Vmn1r58 A C 7: 5,410,452 W260G possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zfp868 A C 8: 69,611,579 H368Q probably damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R7034:Nwd2 UTSW 5 63804915 missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Z1176:Nwd2 UTSW 5 63725197 missense probably damaging 1.00
Z1176:Nwd2 UTSW 5 63806157 missense probably damaging 1.00
Z1177:Nwd2 UTSW 5 63804984 missense possibly damaging 0.60
Z1177:Nwd2 UTSW 5 63807326 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTTGGCCTTCCCAGATGG -3'
(R):5'- CTCTAGGGCATCCAATATGATTACC -3'

Sequencing Primer
(F):5'- CCCAGATGGCCTGTGCATTTATTG -3'
(R):5'- GGCATCCAATATGATTACCAGAGGTC -3'
Posted On2018-09-12