Incidental Mutation 'R6856:Prrc2c'
ID 535232
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Name proline-rich coiled-coil 2C
Synonyms 9630039I18Rik, Bat2d, 1810043M20Rik, Bat2l2
MMRRC Submission 044958-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.410) question?
Stock # R6856 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 162499354-162568125 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 162509940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 2317 (L2317P)
Ref Sequence ENSEMBL: ENSMUSP00000138674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182393] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183223]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000028016
AA Change: L2317P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225
AA Change: L2317P

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182149
AA Change: L2319P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225
AA Change: L2319P

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182393
AA Change: L1035P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138451
Gene: ENSMUSG00000040225
AA Change: L1035P

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
low complexity region 104 125 N/A INTRINSIC
low complexity region 431 462 N/A INTRINSIC
low complexity region 481 519 N/A INTRINSIC
low complexity region 531 548 N/A INTRINSIC
low complexity region 560 625 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 946 968 N/A INTRINSIC
low complexity region 988 1002 N/A INTRINSIC
low complexity region 1037 1054 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1274 1297 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182593
AA Change: L2317P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225
AA Change: L2317P

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182660
AA Change: L2319P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225
AA Change: L2319P

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183223
AA Change: L828P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138698
Gene: ENSMUSG00000040225
AA Change: L828P

DomainStartEndE-ValueType
low complexity region 289 320 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 418 483 N/A INTRINSIC
low complexity region 739 761 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
low complexity region 830 847 N/A INTRINSIC
low complexity region 936 947 N/A INTRINSIC
low complexity region 1062 1085 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1241 1258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,205,755 (GRCm39) M156V probably benign Het
Aire A T 10: 77,866,089 (GRCm39) F546I probably damaging Het
Ankk1 T C 9: 49,331,320 (GRCm39) E230G probably benign Het
Anp32a A T 9: 62,279,397 (GRCm39) K86N possibly damaging Het
Aqp4 T C 18: 15,532,953 (GRCm39) I47V possibly damaging Het
Arap3 A G 18: 38,112,916 (GRCm39) V1098A possibly damaging Het
Ascc3 T A 10: 50,625,158 (GRCm39) W1652R probably damaging Het
Atad2 T A 15: 57,970,209 (GRCm39) H464L probably damaging Het
Brca2 C A 5: 150,463,673 (GRCm39) H1146N possibly damaging Het
Capn9 G A 8: 125,324,308 (GRCm39) V203M probably damaging Het
Ccr6 T A 17: 8,474,881 (GRCm39) S29T probably benign Het
Cfap99 G T 5: 34,467,561 (GRCm39) probably null Het
Cpt1c C T 7: 44,609,342 (GRCm39) G716S probably damaging Het
Dhx29 A T 13: 113,089,395 (GRCm39) Q722L probably benign Het
Dmxl1 C T 18: 49,985,355 (GRCm39) R201* probably null Het
Dsg2 G A 18: 20,734,859 (GRCm39) G946S probably damaging Het
Erg C A 16: 95,169,510 (GRCm39) probably null Het
Fbxo32 G A 15: 58,078,037 (GRCm39) probably benign Het
Gask1b G T 3: 79,793,448 (GRCm39) probably benign Het
Glis1 T G 4: 107,293,076 (GRCm39) D66E probably damaging Het
Grm6 A T 11: 50,750,652 (GRCm39) N605I probably damaging Het
Gtf3c6 T C 10: 40,125,668 (GRCm39) E183G probably benign Het
Herc1 A G 9: 66,305,180 (GRCm39) M861V probably benign Het
Igkv12-41 A T 6: 69,835,513 (GRCm39) S80T probably damaging Het
Itprid2 C T 2: 79,488,049 (GRCm39) R711C probably damaging Het
Kcnt2 T C 1: 140,523,742 (GRCm39) S1057P probably damaging Het
Krt36 T G 11: 99,994,216 (GRCm39) Q287P probably damaging Het
Ldhd A G 8: 112,356,906 (GRCm39) S13P probably benign Het
Lmtk3 T A 7: 45,443,721 (GRCm39) probably benign Het
Lrp2 A T 2: 69,343,612 (GRCm39) F916I probably damaging Het
Map4k1 A T 7: 28,686,259 (GRCm39) I92F probably damaging Het
Naa25 A T 5: 121,576,867 (GRCm39) K872M probably damaging Het
Nek3 C A 8: 22,619,463 (GRCm39) G443V probably damaging Het
Noxred1 T C 12: 87,273,810 (GRCm39) E77G probably benign Het
Nup210 G A 6: 91,064,895 (GRCm39) Q202* probably null Het
Or52d1 A T 7: 103,755,998 (GRCm39) M171L probably benign Het
Or8k27 G T 2: 86,276,251 (GRCm39) S25Y probably benign Het
Pax3 A G 1: 78,109,056 (GRCm39) S201P probably damaging Het
Pcdhgb5 T A 18: 37,866,457 (GRCm39) Y751N probably benign Het
Pign A T 1: 105,481,620 (GRCm39) L792* probably null Het
Pkd1 T C 17: 24,792,467 (GRCm39) F1385L probably benign Het
Plxnb2 A C 15: 89,048,523 (GRCm39) C629G probably benign Het
Prpsap2 A T 11: 61,621,097 (GRCm39) I328N probably benign Het
Ptgfrn T C 3: 100,952,762 (GRCm39) D824G probably damaging Het
Ptpra G A 2: 130,361,301 (GRCm39) S204N probably damaging Het
Pygm G T 19: 6,443,787 (GRCm39) G583C probably damaging Het
Rap1a A G 3: 105,639,384 (GRCm39) F92L probably damaging Het
Slmap A T 14: 26,151,247 (GRCm39) probably null Het
Spdye4c A G 2: 128,438,050 (GRCm39) probably null Het
Speer4a3 A G 5: 26,155,843 (GRCm39) I167T probably benign Het
Stk11 C A 10: 79,963,924 (GRCm39) F97L probably benign Het
Tbc1d9b G A 11: 50,059,573 (GRCm39) A992T probably benign Het
Tmem232 G A 17: 65,757,305 (GRCm39) T296M possibly damaging Het
Trim33 C T 3: 103,259,365 (GRCm39) T1018M probably damaging Het
Trpv2 A C 11: 62,475,441 (GRCm39) I285L probably benign Het
Usp46 A G 5: 74,189,595 (GRCm39) probably benign Het
Vmn1r27 T A 6: 58,192,432 (GRCm39) M191L possibly damaging Het
Vwf G T 6: 125,619,113 (GRCm39) E1264* probably null Het
Zfp109 A T 7: 23,928,823 (GRCm39) N195K probably benign Het
Zfp385b T A 2: 77,246,138 (GRCm39) L208F probably damaging Het
Zfp839 T A 12: 110,833,195 (GRCm39) Y515* probably null Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162,548,182 (GRCm39) splice site probably null
IGL00577:Prrc2c APN 1 162,525,685 (GRCm39) missense unknown
IGL00580:Prrc2c APN 1 162,525,685 (GRCm39) missense unknown
IGL01295:Prrc2c APN 1 162,510,061 (GRCm39) missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162,538,355 (GRCm39) missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162,534,031 (GRCm39) unclassified probably benign
IGL01745:Prrc2c APN 1 162,552,297 (GRCm39) missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162,532,068 (GRCm39) missense probably benign 0.23
IGL01905:Prrc2c APN 1 162,532,898 (GRCm39) unclassified probably benign
IGL02304:Prrc2c APN 1 162,511,705 (GRCm39) missense probably benign 0.05
IGL02389:Prrc2c APN 1 162,520,439 (GRCm39) missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162,550,706 (GRCm39) missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162,533,181 (GRCm39) unclassified probably benign
IGL02686:Prrc2c APN 1 162,535,516 (GRCm39) unclassified probably benign
IGL02795:Prrc2c APN 1 162,541,868 (GRCm39) missense probably benign
IGL02894:Prrc2c APN 1 162,505,626 (GRCm39) missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162,534,104 (GRCm39) unclassified probably benign
IGL02981:Prrc2c APN 1 162,532,748 (GRCm39) unclassified probably benign
IGL03070:Prrc2c APN 1 162,504,978 (GRCm39) missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162,529,928 (GRCm39) missense unknown
R0058:Prrc2c UTSW 1 162,526,453 (GRCm39) missense unknown
R0058:Prrc2c UTSW 1 162,526,453 (GRCm39) missense unknown
R0135:Prrc2c UTSW 1 162,543,052 (GRCm39) splice site probably benign
R0279:Prrc2c UTSW 1 162,543,033 (GRCm39) missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162,525,380 (GRCm39) missense unknown
R0436:Prrc2c UTSW 1 162,532,883 (GRCm39) unclassified probably benign
R0605:Prrc2c UTSW 1 162,509,995 (GRCm39) missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162,536,421 (GRCm39) critical splice donor site probably null
R0981:Prrc2c UTSW 1 162,533,550 (GRCm39) unclassified probably benign
R1693:Prrc2c UTSW 1 162,546,282 (GRCm39) missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162,504,945 (GRCm39) missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162,532,551 (GRCm39) unclassified probably benign
R1794:Prrc2c UTSW 1 162,533,528 (GRCm39) unclassified probably benign
R1998:Prrc2c UTSW 1 162,532,487 (GRCm39) unclassified probably benign
R2040:Prrc2c UTSW 1 162,525,126 (GRCm39) missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162,537,903 (GRCm39) unclassified probably benign
R2246:Prrc2c UTSW 1 162,535,360 (GRCm39) unclassified probably benign
R2830:Prrc2c UTSW 1 162,536,485 (GRCm39) unclassified probably benign
R2926:Prrc2c UTSW 1 162,533,696 (GRCm39) unclassified probably benign
R3703:Prrc2c UTSW 1 162,538,260 (GRCm39) missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162,525,754 (GRCm39) missense unknown
R3760:Prrc2c UTSW 1 162,520,420 (GRCm39) missense probably damaging 1.00
R3784:Prrc2c UTSW 1 162,537,238 (GRCm39) unclassified probably benign
R3959:Prrc2c UTSW 1 162,536,461 (GRCm39) unclassified probably benign
R4255:Prrc2c UTSW 1 162,533,895 (GRCm39) unclassified probably benign
R4276:Prrc2c UTSW 1 162,501,160 (GRCm39) missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R4593:Prrc2c UTSW 1 162,525,101 (GRCm39) missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162,550,843 (GRCm39) missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162,550,843 (GRCm39) missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162,508,464 (GRCm39) missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162,532,748 (GRCm39) unclassified probably benign
R4688:Prrc2c UTSW 1 162,525,256 (GRCm39) missense unknown
R4753:Prrc2c UTSW 1 162,518,799 (GRCm39) missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162,538,050 (GRCm39) missense unknown
R4981:Prrc2c UTSW 1 162,520,116 (GRCm39) missense probably damaging 1.00
R4995:Prrc2c UTSW 1 162,532,879 (GRCm39) unclassified probably benign
R5119:Prrc2c UTSW 1 162,533,009 (GRCm39) unclassified probably benign
R5127:Prrc2c UTSW 1 162,525,415 (GRCm39) missense unknown
R5291:Prrc2c UTSW 1 162,533,151 (GRCm39) unclassified probably benign
R5474:Prrc2c UTSW 1 162,537,213 (GRCm39) unclassified probably benign
R5543:Prrc2c UTSW 1 162,501,080 (GRCm39) missense probably damaging 0.99
R5579:Prrc2c UTSW 1 162,508,327 (GRCm39) critical splice donor site probably null
R5594:Prrc2c UTSW 1 162,526,600 (GRCm39) missense unknown
R5620:Prrc2c UTSW 1 162,501,098 (GRCm39) missense probably damaging 1.00
R5994:Prrc2c UTSW 1 162,501,725 (GRCm39) splice site probably null
R6142:Prrc2c UTSW 1 162,537,956 (GRCm39) missense unknown
R6199:Prrc2c UTSW 1 162,510,085 (GRCm39) missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162,541,883 (GRCm39) missense probably benign
R6504:Prrc2c UTSW 1 162,525,364 (GRCm39) missense unknown
R6671:Prrc2c UTSW 1 162,525,154 (GRCm39) missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162,536,670 (GRCm39) unclassified probably benign
R6799:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6801:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6850:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6851:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6869:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6882:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6884:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6897:Prrc2c UTSW 1 162,533,075 (GRCm39) unclassified probably benign
R6934:Prrc2c UTSW 1 162,548,074 (GRCm39) missense probably benign 0.10
R6976:Prrc2c UTSW 1 162,520,413 (GRCm39) missense probably damaging 1.00
R7132:Prrc2c UTSW 1 162,508,850 (GRCm39) missense possibly damaging 0.77
R7165:Prrc2c UTSW 1 162,501,086 (GRCm39) missense possibly damaging 0.94
R7282:Prrc2c UTSW 1 162,507,543 (GRCm39) missense possibly damaging 0.59
R7467:Prrc2c UTSW 1 162,504,932 (GRCm39) missense possibly damaging 0.84
R7915:Prrc2c UTSW 1 162,519,977 (GRCm39) missense probably benign 0.39
R8068:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R8529:Prrc2c UTSW 1 162,536,663 (GRCm39) unclassified probably benign
R8734:Prrc2c UTSW 1 162,507,081 (GRCm39) missense possibly damaging 0.92
R8735:Prrc2c UTSW 1 162,537,127 (GRCm39) missense unknown
R8813:Prrc2c UTSW 1 162,532,812 (GRCm39) missense unknown
R8946:Prrc2c UTSW 1 162,536,478 (GRCm39) unclassified probably benign
R8975:Prrc2c UTSW 1 162,533,630 (GRCm39) missense unknown
R9035:Prrc2c UTSW 1 162,503,295 (GRCm39) missense possibly damaging 0.96
R9185:Prrc2c UTSW 1 162,532,212 (GRCm39) missense unknown
R9261:Prrc2c UTSW 1 162,505,622 (GRCm39) missense possibly damaging 0.48
R9287:Prrc2c UTSW 1 162,541,843 (GRCm39) missense probably benign 0.34
R9289:Prrc2c UTSW 1 162,507,130 (GRCm39) missense probably benign 0.33
R9466:Prrc2c UTSW 1 162,503,258 (GRCm39) missense possibly damaging 0.53
R9523:Prrc2c UTSW 1 162,525,298 (GRCm39) missense unknown
R9542:Prrc2c UTSW 1 162,508,359 (GRCm39) missense possibly damaging 0.88
R9629:Prrc2c UTSW 1 162,519,959 (GRCm39) missense possibly damaging 0.95
R9744:Prrc2c UTSW 1 162,505,733 (GRCm39) missense possibly damaging 0.96
R9748:Prrc2c UTSW 1 162,535,435 (GRCm39) missense unknown
X0020:Prrc2c UTSW 1 162,535,416 (GRCm39) unclassified probably benign
X0039:Prrc2c UTSW 1 162,532,362 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGTCATGGATGGAAGGGACTC -3'
(R):5'- CCATGGGACCCATAGAATCAGAAG -3'

Sequencing Primer
(F):5'- GGACTCAAACCTAGAAGTACACCTGG -3'
(R):5'- GAGTGAACATGCTACATTTTTCTCC -3'
Posted On 2018-09-12