Incidental Mutation 'R6856:Olfr1065'
ID535236
Institutional Source Beutler Lab
Gene Symbol Olfr1065
Ensembl Gene ENSMUSG00000111306
Gene Nameolfactory receptor 1065
SynonymsMOR190-1, GA_x6K02T2Q125-47915274-47914333
MMRRC Submission
Accession Numbers

Genbank: NM_146408; MGI: 3030899

Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R6856 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86443958-86450591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86445907 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 25 (S25Y)
Ref Sequence ENSEMBL: ENSMUSP00000149248 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000213789
AA Change: S25Y

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000216162
AA Change: S25Y

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000216165
AA Change: S25Y

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000217586
AA Change: S25Y

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Olfr1065
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03133:Olfr1065 APN 2 86445658 missense probably damaging 0.99
IGL03173:Olfr1065 APN 2 86445444 nonsense probably null
IGL03257:Olfr1065 APN 2 86445890 missense probably damaging 0.98
D4043:Olfr1065 UTSW 2 86445220 missense probably damaging 0.99
R0265:Olfr1065 UTSW 2 86445959 missense probably benign 0.00
R0550:Olfr1065 UTSW 2 86445876 nonsense probably null
R0633:Olfr1065 UTSW 2 86445129 missense probably benign 0.45
R0727:Olfr1065 UTSW 2 86445938 missense probably benign 0.00
R1017:Olfr1065 UTSW 2 86445428 missense probably benign 0.13
R1416:Olfr1065 UTSW 2 86445320 missense probably benign 0.43
R1657:Olfr1065 UTSW 2 86445218 missense probably damaging 1.00
R1983:Olfr1065 UTSW 2 86445076 missense probably benign 0.01
R3919:Olfr1065 UTSW 2 86445418 missense probably benign 0.01
R4345:Olfr1065 UTSW 2 86445845 missense probably damaging 1.00
R5382:Olfr1065 UTSW 2 86445316 missense probably damaging 0.99
R5757:Olfr1065 UTSW 2 86445578 missense probably benign 0.22
R6530:Olfr1065 UTSW 2 86445482 missense probably benign 0.31
R6765:Olfr1065 UTSW 2 86445236 missense probably benign 0.04
R7156:Olfr1065 UTSW 2 86445308 missense probably damaging 1.00
R8239:Olfr1065 UTSW 2 86445129 missense noncoding transcript
R8338:Olfr1065 UTSW 2 86445385 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTTTGGGTCCCACAGTTG -3'
(R):5'- AGGAGCAAGTGTGTTATACATGTG -3'

Sequencing Primer
(F):5'- GGGTCCCACAGTTGTTGAATAACC -3'
(R):5'- TTAGAACAGGCTGTCTCAT -3'
Posted On2018-09-12