Mutagenetix > Incidental Mutations

Incidental Mutation 'R6856:Ptpra'

535238

Institutional Source

Beutler Lab

Gene Symbol

Ptpra

Ensembl Gene

ENSMUSG00000027303

Gene Name

protein tyrosine phosphatase, receptor type, A

Synonyms

PTPalpha, RPTRalpha, Ptpa, PTP[a], RPTPalpha

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6856 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130450278-130556124 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 130519381 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 204 (S204N)

Ref Sequence

ENSEMBL: ENSMUSP00000155099 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303] [ENSMUST00000230981]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028769
AA Change: S195N

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: S195N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	49	61	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
transmembrane domain	143	165	N/A	INTRINSIC
PTPc	231	494	6.01e-130	SMART
PTPc	523	784	3.56e-132	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077303
AA Change: S195N

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: S195N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	49	61	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
transmembrane domain	143	165	N/A	INTRINSIC
PTPc	231	530	2.03e-118	SMART
PTPc	559	820	3.56e-132	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000230981
AA Change: S204N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl4	A	G	3: 151,500,118	M156V	probably benign	Het
Aire	A	T	10: 78,030,255	F546I	probably damaging	Het
Ankk1	T	C	9: 49,420,020	E230G	probably benign	Het
Anp32a	A	T	9: 62,372,115	K86N	possibly damaging	Het
Aqp4	T	C	18: 15,399,896	I47V	possibly damaging	Het
Arap3	A	G	18: 37,979,863	V1098A	possibly damaging	Het
Ascc3	T	A	10: 50,749,062	W1652R	probably damaging	Het
Atad2	T	A	15: 58,106,813	H464L	probably damaging	Het
Brca2	C	A	5: 150,540,208	H1146N	possibly damaging	Het
Capn9	G	A	8: 124,597,569	V203M	probably damaging	Het
Ccr6	T	A	17: 8,256,049	S29T	probably benign	Het
Cfap99	G	T	5: 34,310,217		probably null	Het
Cpt1c	C	T	7: 44,959,918	G716S	probably damaging	Het
Dhx29	A	T	13: 112,952,861	Q722L	probably benign	Het
Dmxl1	C	T	18: 49,852,288	R201*	probably null	Het
Dsg2	G	A	18: 20,601,802	G946S	probably damaging	Het
Erg	C	A	16: 95,368,651		probably null	Het
Fam198b	G	T	3: 79,886,141		probably benign	Het
Fbxo32	G	A	15: 58,214,641		probably benign	Het
Glis1	T	G	4: 107,435,879	D66E	probably damaging	Het
Gm21671	A	G	5: 25,950,845	I167T	probably benign	Het
Grm6	A	T	11: 50,859,825	N605I	probably damaging	Het
Gtf3c6	T	C	10: 40,249,672	E183G	probably benign	Het
Herc1	A	G	9: 66,397,898	M861V	probably benign	Het
Igkv12-41	A	T	6: 69,858,529	S80T	probably damaging	Het
Kcnt2	T	C	1: 140,596,004	S1057P	probably damaging	Het
Krt36	T	G	11: 100,103,390	Q287P	probably damaging	Het
Ldhd	A	G	8: 111,630,274	S13P	probably benign	Het
Lmtk3	T	A	7: 45,794,297		probably benign	Het
Lrp2	A	T	2: 69,513,268	F916I	probably damaging	Het
Map4k1	A	T	7: 28,986,834	I92F	probably damaging	Het
Naa25	A	T	5: 121,438,804	K872M	probably damaging	Het
Nek3	C	A	8: 22,129,447	G443V	probably damaging	Het
Noxred1	T	C	12: 87,227,036	E77G	probably benign	Het
Nup210	G	A	6: 91,087,913	Q202*	probably null	Het
Olfr1065	G	T	2: 86,445,907	S25Y	probably benign	Het
Olfr646	A	T	7: 104,106,791	M171L	probably benign	Het
Pax3	A	G	1: 78,132,419	S201P	probably damaging	Het
Pcdhgb5	T	A	18: 37,733,404	Y751N	probably benign	Het
Pign	A	T	1: 105,553,895	L792*	probably null	Het
Pkd1	T	C	17: 24,573,493	F1385L	probably benign	Het
Plxnb2	A	C	15: 89,164,320	C629G	probably benign	Het
Prpsap2	A	T	11: 61,730,271	I328N	probably benign	Het
Prrc2c	A	G	1: 162,682,371	L2317P	probably damaging	Het
Ptgfrn	T	C	3: 101,045,446	D824G	probably damaging	Het
Pygm	G	T	19: 6,393,757	G583C	probably damaging	Het
Rap1a	A	G	3: 105,732,068	F92L	probably damaging	Het
Slmap	A	T	14: 26,430,092		probably null	Het
Spdye4c	A	G	2: 128,596,130		probably null	Het
Ssfa2	C	T	2: 79,657,705	R711C	probably damaging	Het
Stk11	C	A	10: 80,128,090	F97L	probably benign	Het
Tbc1d9b	G	A	11: 50,168,746	A992T	probably benign	Het
Tmem232	G	A	17: 65,450,310	T296M	possibly damaging	Het
Trim33	C	T	3: 103,352,049	T1018M	probably damaging	Het
Trpv2	A	C	11: 62,584,615	I285L	probably benign	Het
Usp46	A	G	5: 74,028,934		probably benign	Het
Vmn1r27	T	A	6: 58,215,447	M191L	possibly damaging	Het
Vwf	G	T	6: 125,642,150	E1264*	probably null	Het
Zfp109	A	T	7: 24,229,398	N195K	probably benign	Het
Zfp385b	T	A	2: 77,415,794	L208F	probably damaging	Het
Zfp839	T	A	12: 110,866,761	Y515*	probably null	Het

Other mutations in Ptpra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01411:Ptpra	APN	2	130544439	missense	probably damaging	1.00
IGL01734:Ptpra	APN	2	130544077	missense	probably damaging	1.00
IGL02218:Ptpra	APN	2	130552335	splice site	probably benign
IGL02385:Ptpra	APN	2	130540473	unclassified	probably benign
IGL02480:Ptpra	APN	2	130504261	missense	probably benign	0.09
IGL03181:Ptpra	APN	2	130517787	missense	probably damaging	0.99
R0374:Ptpra	UTSW	2	130537621	missense	probably damaging	1.00
R0483:Ptpra	UTSW	2	130539685	missense	probably damaging	1.00
R0848:Ptpra	UTSW	2	130518991	missense	probably damaging	1.00
R1550:Ptpra	UTSW	2	130541393	missense	possibly damaging	0.86
R1596:Ptpra	UTSW	2	130544952	missense	probably damaging	1.00
R1689:Ptpra	UTSW	2	130503492	missense	probably benign	0.01
R1760:Ptpra	UTSW	2	130549827	missense	probably damaging	1.00
R1943:Ptpra	UTSW	2	130544104	missense	probably damaging	1.00
R2114:Ptpra	UTSW	2	130539735	missense	probably damaging	1.00
R2115:Ptpra	UTSW	2	130539735	missense	probably damaging	1.00
R2117:Ptpra	UTSW	2	130539735	missense	probably damaging	1.00
R2187:Ptpra	UTSW	2	130504299	missense	probably benign
R2848:Ptpra	UTSW	2	130544999	missense	probably benign	0.06
R2849:Ptpra	UTSW	2	130544999	missense	probably benign	0.06
R4644:Ptpra	UTSW	2	130544158	missense	probably damaging	1.00
R4779:Ptpra	UTSW	2	130537617	missense	probably damaging	1.00
R4849:Ptpra	UTSW	2	130532161	missense	probably damaging	1.00
R4899:Ptpra	UTSW	2	130544436	missense	probably damaging	1.00
R5657:Ptpra	UTSW	2	130504284	missense	probably benign	0.06
R6018:Ptpra	UTSW	2	130503502	missense	probably benign
R6234:Ptpra	UTSW	2	130537588	missense	probably damaging	1.00
R6350:Ptpra	UTSW	2	130540592	missense	probably damaging	1.00
R7072:Ptpra	UTSW	2	130553430	missense	probably damaging	1.00
R7146:Ptpra	UTSW	2	130537651	critical splice donor site	probably null
R7220:Ptpra	UTSW	2	130544497	missense	probably damaging	1.00
R7346:Ptpra	UTSW	2	130553400	missense	probably damaging	1.00
R7819:Ptpra	UTSW	2	130504206	missense	probably benign
R8044:Ptpra	UTSW	2	130544961	missense	possibly damaging	0.93
R8231:Ptpra	UTSW	2	130537603	missense	probably damaging	1.00
R8404:Ptpra	UTSW	2	130549759	missense	probably damaging	1.00
R8422:Ptpra	UTSW	2	130532171	missense	possibly damaging	0.86
R8502:Ptpra	UTSW	2	130549759	missense	probably damaging	1.00
R8683:Ptpra	UTSW	2	130552267	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ACTCTTTCCGCCTGTCAAATGG -3'
(R):5'- ATGACTCAGAAGGCTGGACC -3'

Sequencing Primer
(F):5'- ACATGCAAGAGCTGGTTCTC -3'
(R):5'- CTTAGGTCTCCCTTCCTCTGCTAAC -3'

Posted On

2018-09-12