Mutagenetix > Incidental Mutation

Incidental Mutation 'R6856:Ptgfrn'

535240

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6856 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101045446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 824 (D824G)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably damaging
Transcript: ENSMUST00000102694
AA Change: D824G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: D824G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl4	A	G	3: 151,500,118	M156V	probably benign	Het
Aire	A	T	10: 78,030,255	F546I	probably damaging	Het
Ankk1	T	C	9: 49,420,020	E230G	probably benign	Het
Anp32a	A	T	9: 62,372,115	K86N	possibly damaging	Het
Aqp4	T	C	18: 15,399,896	I47V	possibly damaging	Het
Arap3	A	G	18: 37,979,863	V1098A	possibly damaging	Het
Ascc3	T	A	10: 50,749,062	W1652R	probably damaging	Het
Atad2	T	A	15: 58,106,813	H464L	probably damaging	Het
Brca2	C	A	5: 150,540,208	H1146N	possibly damaging	Het
Capn9	G	A	8: 124,597,569	V203M	probably damaging	Het
Ccr6	T	A	17: 8,256,049	S29T	probably benign	Het
Cfap99	G	T	5: 34,310,217		probably null	Het
Cpt1c	C	T	7: 44,959,918	G716S	probably damaging	Het
Dhx29	A	T	13: 112,952,861	Q722L	probably benign	Het
Dmxl1	C	T	18: 49,852,288	R201*	probably null	Het
Dsg2	G	A	18: 20,601,802	G946S	probably damaging	Het
Erg	C	A	16: 95,368,651		probably null	Het
Fam198b	G	T	3: 79,886,141		probably benign	Het
Fbxo32	G	A	15: 58,214,641		probably benign	Het
Glis1	T	G	4: 107,435,879	D66E	probably damaging	Het
Gm21671	A	G	5: 25,950,845	I167T	probably benign	Het
Grm6	A	T	11: 50,859,825	N605I	probably damaging	Het
Gtf3c6	T	C	10: 40,249,672	E183G	probably benign	Het
Herc1	A	G	9: 66,397,898	M861V	probably benign	Het
Igkv12-41	A	T	6: 69,858,529	S80T	probably damaging	Het
Kcnt2	T	C	1: 140,596,004	S1057P	probably damaging	Het
Krt36	T	G	11: 100,103,390	Q287P	probably damaging	Het
Ldhd	A	G	8: 111,630,274	S13P	probably benign	Het
Lmtk3	T	A	7: 45,794,297		probably benign	Het
Lrp2	A	T	2: 69,513,268	F916I	probably damaging	Het
Map4k1	A	T	7: 28,986,834	I92F	probably damaging	Het
Naa25	A	T	5: 121,438,804	K872M	probably damaging	Het
Nek3	C	A	8: 22,129,447	G443V	probably damaging	Het
Noxred1	T	C	12: 87,227,036	E77G	probably benign	Het
Nup210	G	A	6: 91,087,913	Q202*	probably null	Het
Olfr1065	G	T	2: 86,445,907	S25Y	probably benign	Het
Olfr646	A	T	7: 104,106,791	M171L	probably benign	Het
Pax3	A	G	1: 78,132,419	S201P	probably damaging	Het
Pcdhgb5	T	A	18: 37,733,404	Y751N	probably benign	Het
Pign	A	T	1: 105,553,895	L792*	probably null	Het
Pkd1	T	C	17: 24,573,493	F1385L	probably benign	Het
Plxnb2	A	C	15: 89,164,320	C629G	probably benign	Het
Prpsap2	A	T	11: 61,730,271	I328N	probably benign	Het
Prrc2c	A	G	1: 162,682,371	L2317P	probably damaging	Het
Ptpra	G	A	2: 130,519,381	S204N	probably damaging	Het
Pygm	G	T	19: 6,393,757	G583C	probably damaging	Het
Rap1a	A	G	3: 105,732,068	F92L	probably damaging	Het
Slmap	A	T	14: 26,430,092		probably null	Het
Spdye4c	A	G	2: 128,596,130		probably null	Het
Ssfa2	C	T	2: 79,657,705	R711C	probably damaging	Het
Stk11	C	A	10: 80,128,090	F97L	probably benign	Het
Tbc1d9b	G	A	11: 50,168,746	A992T	probably benign	Het
Tmem232	G	A	17: 65,450,310	T296M	possibly damaging	Het
Trim33	C	T	3: 103,352,049	T1018M	probably damaging	Het
Trpv2	A	C	11: 62,584,615	I285L	probably benign	Het
Usp46	A	G	5: 74,028,934		probably benign	Het
Vmn1r27	T	A	6: 58,215,447	M191L	possibly damaging	Het
Vwf	G	T	6: 125,642,150	E1264*	probably null	Het
Zfp109	A	T	7: 24,229,398	N195K	probably benign	Het
Zfp385b	T	A	2: 77,415,794	L208F	probably damaging	Het
Zfp839	T	A	12: 110,866,761	Y515*	probably null	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGCTTCCACTGAATCAC -3'
(R):5'- CTGGAAGAGTACTGTCAGCCTG -3'

Sequencing Primer
(F):5'- AAAAGTCCTTCCCCAGTGGTG -3'
(R):5'- CTGGAGCGAGTGAGCGTG -3'

Posted On

2018-09-12