Incidental Mutation 'R6856:Trim33'
ID535241
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6856 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103352049 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1018 (T1018M)
Ref Sequence ENSEMBL: ENSMUSP00000102473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029444
AA Change: T1018M

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: T1018M

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106860
AA Change: T1018M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: T1018M

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000198706
SMART Domains Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
Blast:BBC 1 30 9e-11 BLAST
low complexity region 111 154 N/A INTRINSIC
low complexity region 302 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Bemoaned UTSW 3 103326793 missense possibly damaging 0.92
Excision UTSW 3 103344576 missense probably damaging 1.00
Peaked UTSW 3 103337532 critical splice donor site probably null
Pike UTSW 3 103310885 missense probably damaging 0.98
westworld UTSW 3 103326901 missense possibly damaging 0.46
R0143:Trim33 UTSW 3 103352101 missense probably benign 0.00
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0573:Trim33 UTSW 3 103351990 splice site probably benign
R0586:Trim33 UTSW 3 103310344 missense probably damaging 0.99
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103310434 unclassified probably benign
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R3878:Trim33 UTSW 3 103352005 missense probably damaging 1.00
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4809:Trim33 UTSW 3 103329256 missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6636:Trim33 UTSW 3 103353719 missense probably damaging 1.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R7220:Trim33 UTSW 3 103326793 missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103321636 missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103310323 missense probably damaging 0.98
R7430:Trim33 UTSW 3 103310903 missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103346640 splice site probably benign
R7491:Trim33 UTSW 3 103326148 missense probably benign 0.28
R8001:Trim33 UTSW 3 103311515 critical splice donor site probably null
R8127:Trim33 UTSW 3 103331727 missense possibly damaging 0.66
RF005:Trim33 UTSW 3 103280212 frame shift probably null
RF007:Trim33 UTSW 3 103280217 small deletion probably benign
RF014:Trim33 UTSW 3 103329092 missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103280217 small deletion probably benign
RF064:Trim33 UTSW 3 103280195 frame shift probably null
Z1176:Trim33 UTSW 3 103353727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCATGTATCCTGCAGTAAG -3'
(R):5'- AATTAGTTGGTTCTTTCAACAGGGG -3'

Sequencing Primer
(F):5'- CAGCATGTATCCTGCAGTAAGATCTG -3'
(R):5'- GCCAATACTCTATAGGTTGGAA -3'
Posted On2018-09-12