Mutagenetix > Incidental Mutations

Incidental Mutation 'R6856:Vwf'

535253

Institutional Source

Beutler Lab

Gene Symbol

Vwf

Ensembl Gene

ENSMUSG00000001930

Gene Name

Von Willebrand factor

Synonyms

6820430P06Rik, B130011O06Rik

MMRRC Submission

Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R6856 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

125546774-125686679 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 125642150 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1264 (E1264*)

Ref Sequence

ENSEMBL: ENSMUSP00000107873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112254]

Predicted Effect

probably null
Transcript: ENSMUST00000112254
AA Change: E1264*

SMART Domains

Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: E1264*

Domain	Start	End	E-Value	Type
VWD	23	181	3.43e-35	SMART
C8	221	295	1.11e-21	SMART
Pfam:TIL	298	351	6.9e-15	PFAM
VWC	353	413	8.71e-1	SMART
VWD	380	543	2.93e-52	SMART
C8	580	652	3.82e-25	SMART
Pfam:TIL	655	710	4.1e-14	PFAM
EGF_like	790	825	4.37e1	SMART
VWC	832	901	3.29e-3	SMART
VWD	859	1015	5.15e-39	SMART
C8	1056	1130	1.01e-33	SMART
Pfam:TIL	1144	1199	1.3e-9	PFAM
VWA	1278	1461	1.81e-20	SMART
low complexity region	1464	1477	N/A	INTRINSIC
VWA	1499	1672	8.43e-39	SMART
VWA	1692	1875	2.83e-31	SMART
VWC	1882	1949	2.99e0	SMART
VWD	1941	2104	5.03e-42	SMART
C8	2135	2203	1.29e-13	SMART
Pfam:TIL	2206	2257	8.3e-8	PFAM
VWC	2260	2328	3.16e-16	SMART
low complexity region	2417	2428	N/A	INTRINSIC
VWC	2434	2497	2.61e-17	SMART
VWC	2513	2577	3.37e0	SMART
VWC	2585	2647	2.55e-11	SMART
CT	2730	2815	1.37e-31	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl4	A	G	3: 151,500,118	M156V	probably benign	Het
Aire	A	T	10: 78,030,255	F546I	probably damaging	Het
Ankk1	T	C	9: 49,420,020	E230G	probably benign	Het
Anp32a	A	T	9: 62,372,115	K86N	possibly damaging	Het
Aqp4	T	C	18: 15,399,896	I47V	possibly damaging	Het
Arap3	A	G	18: 37,979,863	V1098A	possibly damaging	Het
Ascc3	T	A	10: 50,749,062	W1652R	probably damaging	Het
Atad2	T	A	15: 58,106,813	H464L	probably damaging	Het
Brca2	C	A	5: 150,540,208	H1146N	possibly damaging	Het
Capn9	G	A	8: 124,597,569	V203M	probably damaging	Het
Ccr6	T	A	17: 8,256,049	S29T	probably benign	Het
Cfap99	G	T	5: 34,310,217		probably null	Het
Cpt1c	C	T	7: 44,959,918	G716S	probably damaging	Het
Dhx29	A	T	13: 112,952,861	Q722L	probably benign	Het
Dmxl1	C	T	18: 49,852,288	R201*	probably null	Het
Dsg2	G	A	18: 20,601,802	G946S	probably damaging	Het
Erg	C	A	16: 95,368,651		probably null	Het
Fam198b	G	T	3: 79,886,141		probably benign	Het
Fbxo32	G	A	15: 58,214,641		probably benign	Het
Glis1	T	G	4: 107,435,879	D66E	probably damaging	Het
Gm21671	A	G	5: 25,950,845	I167T	probably benign	Het
Grm6	A	T	11: 50,859,825	N605I	probably damaging	Het
Gtf3c6	T	C	10: 40,249,672	E183G	probably benign	Het
Herc1	A	G	9: 66,397,898	M861V	probably benign	Het
Igkv12-41	A	T	6: 69,858,529	S80T	probably damaging	Het
Kcnt2	T	C	1: 140,596,004	S1057P	probably damaging	Het
Krt36	T	G	11: 100,103,390	Q287P	probably damaging	Het
Ldhd	A	G	8: 111,630,274	S13P	probably benign	Het
Lmtk3	T	A	7: 45,794,297		probably benign	Het
Lrp2	A	T	2: 69,513,268	F916I	probably damaging	Het
Map4k1	A	T	7: 28,986,834	I92F	probably damaging	Het
Naa25	A	T	5: 121,438,804	K872M	probably damaging	Het
Nek3	C	A	8: 22,129,447	G443V	probably damaging	Het
Noxred1	T	C	12: 87,227,036	E77G	probably benign	Het
Nup210	G	A	6: 91,087,913	Q202*	probably null	Het
Olfr1065	G	T	2: 86,445,907	S25Y	probably benign	Het
Olfr646	A	T	7: 104,106,791	M171L	probably benign	Het
Pax3	A	G	1: 78,132,419	S201P	probably damaging	Het
Pcdhgb5	T	A	18: 37,733,404	Y751N	probably benign	Het
Pign	A	T	1: 105,553,895	L792*	probably null	Het
Pkd1	T	C	17: 24,573,493	F1385L	probably benign	Het
Plxnb2	A	C	15: 89,164,320	C629G	probably benign	Het
Prpsap2	A	T	11: 61,730,271	I328N	probably benign	Het
Prrc2c	A	G	1: 162,682,371	L2317P	probably damaging	Het
Ptgfrn	T	C	3: 101,045,446	D824G	probably damaging	Het
Ptpra	G	A	2: 130,519,381	S204N	probably damaging	Het
Pygm	G	T	19: 6,393,757	G583C	probably damaging	Het
Rap1a	A	G	3: 105,732,068	F92L	probably damaging	Het
Slmap	A	T	14: 26,430,092		probably null	Het
Spdye4c	A	G	2: 128,596,130		probably null	Het
Ssfa2	C	T	2: 79,657,705	R711C	probably damaging	Het
Stk11	C	A	10: 80,128,090	F97L	probably benign	Het
Tbc1d9b	G	A	11: 50,168,746	A992T	probably benign	Het
Tmem232	G	A	17: 65,450,310	T296M	possibly damaging	Het
Trim33	C	T	3: 103,352,049	T1018M	probably damaging	Het
Trpv2	A	C	11: 62,584,615	I285L	probably benign	Het
Usp46	A	G	5: 74,028,934		probably benign	Het
Vmn1r27	T	A	6: 58,215,447	M191L	possibly damaging	Het
Zfp109	A	T	7: 24,229,398	N195K	probably benign	Het
Zfp385b	T	A	2: 77,415,794	L208F	probably damaging	Het
Zfp839	T	A	12: 110,866,761	Y515*	probably null	Het

Other mutations in Vwf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Vwf	APN	6	125658872	missense	unknown
IGL00561:Vwf	APN	6	125642721	missense	possibly damaging	0.88
IGL01104:Vwf	APN	6	125683556	missense	probably damaging	1.00
IGL01404:Vwf	APN	6	125677970	missense	probably damaging	1.00
IGL01539:Vwf	APN	6	125590262	missense	possibly damaging	0.85
IGL01550:Vwf	APN	6	125679289	missense	probably benign	0.00
IGL01563:Vwf	APN	6	125591165	missense	probably damaging	1.00
IGL01637:Vwf	APN	6	125645736	missense	probably damaging	1.00
IGL01720:Vwf	APN	6	125642835	missense	possibly damaging	0.69
IGL01834:Vwf	APN	6	125590170	splice site	probably benign
IGL02103:Vwf	APN	6	125646355	missense	probably damaging	1.00
IGL02120:Vwf	APN	6	125616034	missense	probably benign	0.26
IGL02174:Vwf	APN	6	125555395	missense	probably damaging	1.00
IGL02203:Vwf	APN	6	125642406	missense	probably damaging	1.00
IGL02420:Vwf	APN	6	125677916	missense	probably benign	0.00
IGL02723:Vwf	APN	6	125642930	missense	possibly damaging	0.85
IGL02818:Vwf	APN	6	125663548	missense	probably benign
IGL02931:Vwf	APN	6	125615968	missense	possibly damaging	0.68
IGL03015:Vwf	APN	6	125684138	splice site	probably benign
IGL03038:Vwf	APN	6	125604157	missense	possibly damaging	0.92
IGL03060:Vwf	APN	6	125663560	missense	probably damaging	1.00
IGL03114:Vwf	APN	6	125599363	nonsense	probably null
IGL03266:Vwf	APN	6	125678077	splice site	probably benign
B5639:Vwf	UTSW	6	125642984	missense	probably damaging	1.00
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0087:Vwf	UTSW	6	125645954	missense	probably benign	0.03
R0194:Vwf	UTSW	6	125643297	missense	probably benign
R0206:Vwf	UTSW	6	125637456	missense	probably damaging	1.00
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0390:Vwf	UTSW	6	125626361	nonsense	probably null
R0427:Vwf	UTSW	6	125673939	missense	probably benign
R0437:Vwf	UTSW	6	125566318	missense	probably damaging	1.00
R0470:Vwf	UTSW	6	125628428	missense	possibly damaging	0.70
R0499:Vwf	UTSW	6	125638114	missense	probably benign	0.10
R0554:Vwf	UTSW	6	125642781	missense	probably benign	0.13
R0605:Vwf	UTSW	6	125685837	missense	probably benign	0.02
R0711:Vwf	UTSW	6	125626271	missense	probably benign	0.01
R0723:Vwf	UTSW	6	125566262	missense	probably benign	0.01
R0973:Vwf	UTSW	6	125643006	missense	probably damaging	1.00
R1054:Vwf	UTSW	6	125590227	missense	probably damaging	1.00
R1115:Vwf	UTSW	6	125655065	missense	unknown
R1156:Vwf	UTSW	6	125637488	missense	probably damaging	1.00
R1191:Vwf	UTSW	6	125599252	missense	probably damaging	1.00
R1240:Vwf	UTSW	6	125603308	intron	probably null
R1398:Vwf	UTSW	6	125603457	missense	probably benign	0.02
R1435:Vwf	UTSW	6	125642249	nonsense	probably null
R1528:Vwf	UTSW	6	125608291	missense	possibly damaging	0.69
R1575:Vwf	UTSW	6	125655251	missense	unknown
R1575:Vwf	UTSW	6	125663571	nonsense	probably null
R1628:Vwf	UTSW	6	125647738	unclassified	probably benign
R1669:Vwf	UTSW	6	125647906	missense	possibly damaging	0.92
R1699:Vwf	UTSW	6	125643069	missense	probably damaging	1.00
R1699:Vwf	UTSW	6	125685900	missense	possibly damaging	0.74
R1725:Vwf	UTSW	6	125646282	missense	probably benign	0.05
R1742:Vwf	UTSW	6	125667550	missense	probably benign	0.02
R1809:Vwf	UTSW	6	125590175	splice site	probably benign
R1833:Vwf	UTSW	6	125642037	missense	probably benign	0.14
R1866:Vwf	UTSW	6	125667529	missense	possibly damaging	0.62
R1870:Vwf	UTSW	6	125642939	missense	probably damaging	1.00
R1874:Vwf	UTSW	6	125628372	missense	probably benign	0.00
R1941:Vwf	UTSW	6	125639279	missense	possibly damaging	0.64
R2061:Vwf	UTSW	6	125591188	missense	probably damaging	0.98
R2103:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2104:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2130:Vwf	UTSW	6	125657057	missense	probably damaging	1.00
R2159:Vwf	UTSW	6	125626341	missense	probably damaging	0.99
R2178:Vwf	UTSW	6	125642132	missense	possibly damaging	0.90
R2656:Vwf	UTSW	6	125555361	missense	probably benign	0.00
R2913:Vwf	UTSW	6	125685846	missense	probably benign	0.08
R2917:Vwf	UTSW	6	125608143	missense	probably benign	0.07
R3726:Vwf	UTSW	6	125677948	utr 3 prime	probably benign
R3735:Vwf	UTSW	6	125588613	missense	probably damaging	1.00
R3774:Vwf	UTSW	6	125649099	intron	probably null
R3934:Vwf	UTSW	6	125555499	missense	probably damaging	1.00
R4291:Vwf	UTSW	6	125642322	missense	probably damaging	1.00
R4384:Vwf	UTSW	6	125655116	missense	unknown
R4743:Vwf	UTSW	6	125684091	critical splice acceptor site	probably null
R4760:Vwf	UTSW	6	125570604	missense	probably damaging	1.00
R4776:Vwf	UTSW	6	125566305	missense	possibly damaging	0.53
R4791:Vwf	UTSW	6	125643363	missense
R4871:Vwf	UTSW	6	125686462	missense	probably benign	0.25
R4894:Vwf	UTSW	6	125645934	nonsense	probably null
R4963:Vwf	UTSW	6	125667483	nonsense	probably null
R5010:Vwf	UTSW	6	125566257	missense	probably benign	0.15
R5289:Vwf	UTSW	6	125667510	utr 3 prime	probably benign
R5512:Vwf	UTSW	6	125673887	utr 3 prime	probably benign
R5523:Vwf	UTSW	6	125643042	missense
R5642:Vwf	UTSW	6	125603418	missense
R5860:Vwf	UTSW	6	125643090	missense
R5860:Vwf	UTSW	6	125679265	utr 3 prime	probably benign
R5896:Vwf	UTSW	6	125678762	critical splice acceptor site	probably null
R5926:Vwf	UTSW	6	125604174	missense	probably damaging	1.00
R5976:Vwf	UTSW	6	125603463	missense
R6053:Vwf	UTSW	6	125600665	missense	probably benign	0.21
R6151:Vwf	UTSW	6	125657065	missense	unknown
R6179:Vwf	UTSW	6	125649289	missense	unknown
R6181:Vwf	UTSW	6	125566146	missense	probably damaging	0.98
R6234:Vwf	UTSW	6	125657165	missense	unknown
R6360:Vwf	UTSW	6	125683526	missense	probably benign	0.13
R6412:Vwf	UTSW	6	125679316	missense	probably benign	0.00
R6464:Vwf	UTSW	6	125639400	critical splice donor site	probably null
R6522:Vwf	UTSW	6	125662963	critical splice acceptor site	probably null
R6766:Vwf	UTSW	6	125639376	missense	unknown
R6877:Vwf	UTSW	6	125657201	missense	possibly damaging	0.48
R6896:Vwf	UTSW	6	125566194	missense	probably damaging	1.00
R7113:Vwf	UTSW	6	125655044	missense
R7287:Vwf	UTSW	6	125637467	missense
R7359:Vwf	UTSW	6	125566257	missense
R7509:Vwf	UTSW	6	125642169	missense
R7519:Vwf	UTSW	6	125667543	missense
R7545:Vwf	UTSW	6	125614097	missense
R7549:Vwf	UTSW	6	125626267	missense
R7593:Vwf	UTSW	6	125647768	missense
R7635:Vwf	UTSW	6	125682734	missense
R7793:Vwf	UTSW	6	125686520	missense
R7802:Vwf	UTSW	6	125666677	missense
R7824:Vwf	UTSW	6	125658815	missense
R7849:Vwf	UTSW	6	125656803	missense
R7900:Vwf	UTSW	6	125628476	critical splice donor site	probably null
R7932:Vwf	UTSW	6	125656803	missense
R7983:Vwf	UTSW	6	125628476	critical splice donor site	probably null
X0021:Vwf	UTSW	6	125646331	missense	probably damaging	1.00
X0065:Vwf	UTSW	6	125603433	missense	probably null	0.05
Z1176:Vwf	UTSW	6	125591231	missense
Z1176:Vwf	UTSW	6	125603308	intron	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGACCTGCTTGATGGGAG -3'
(R):5'- GGAGCCATCATGGTACTCTAC -3'

Sequencing Primer
(F):5'- AGCAGGCAGGACGTTCCATG -3'
(R):5'- TACCACTGCCACGCGGATG -3'

Posted On

2018-09-12