Incidental Mutation 'R6856:Lmtk3'
ID535257
Institutional Source Beutler Lab
Gene Symbol Lmtk3
Ensembl Gene ENSMUSG00000062044
Gene Namelemur tyrosine kinase 3
SynonymsAATYK3, Aatyk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R6856 (G1)
Quality Score146.008
Status Not validated
Chromosome7
Chromosomal Location45783738-45804144 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 45794297 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000072580] [ENSMUST00000120005] [ENSMUST00000209617] [ENSMUST00000209701]
Predicted Effect unknown
Transcript: ENSMUST00000072580
AA Change: S775R
SMART Domains Protein: ENSMUSP00000072388
Gene: ENSMUSG00000062044
AA Change: S775R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120005
AA Change: S775R
SMART Domains Protein: ENSMUSP00000112592
Gene: ENSMUSG00000062044
AA Change: S775R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209351
Predicted Effect unknown
Transcript: ENSMUST00000209617
AA Change: S801R
Predicted Effect probably benign
Transcript: ENSMUST00000209701
Predicted Effect probably benign
Transcript: ENSMUST00000211127
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pronounced behavioral abnormalities, including locomotor hyperactivity, reduced anxiety, and decreased depression-like behavior, an increased striatal dopamine turnover rate, and enhanced behavioral response to methylphenidate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Lmtk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lmtk3 APN 7 45790907 missense probably damaging 1.00
IGL01996:Lmtk3 APN 7 45793447 unclassified probably null
IGL02146:Lmtk3 APN 7 45794947 unclassified probably benign
IGL02192:Lmtk3 APN 7 45794509 unclassified probably benign
IGL02598:Lmtk3 APN 7 45793140 missense probably damaging 1.00
BB006:Lmtk3 UTSW 7 45795148 missense unknown
BB016:Lmtk3 UTSW 7 45795148 missense unknown
R0469:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0510:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0603:Lmtk3 UTSW 7 45795556 unclassified probably benign
R0781:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1110:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1270:Lmtk3 UTSW 7 45793828 missense probably damaging 0.96
R1535:Lmtk3 UTSW 7 45794570 unclassified probably benign
R1666:Lmtk3 UTSW 7 45794164 missense probably benign 0.03
R1807:Lmtk3 UTSW 7 45793278 missense probably benign 0.02
R1883:Lmtk3 UTSW 7 45786849 missense probably damaging 1.00
R2060:Lmtk3 UTSW 7 45800911 critical splice acceptor site probably null
R2107:Lmtk3 UTSW 7 45793969 missense possibly damaging 0.56
R2214:Lmtk3 UTSW 7 45794853 unclassified probably benign
R2369:Lmtk3 UTSW 7 45795088 unclassified probably benign
R4084:Lmtk3 UTSW 7 45793292 missense probably damaging 0.97
R4246:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4247:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4249:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4250:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4587:Lmtk3 UTSW 7 45794080 missense possibly damaging 0.92
R5026:Lmtk3 UTSW 7 45794412 unclassified probably benign
R5275:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5295:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5624:Lmtk3 UTSW 7 45786862 missense probably damaging 0.96
R5688:Lmtk3 UTSW 7 45791410 missense probably damaging 1.00
R6478:Lmtk3 UTSW 7 45798589 missense unknown
R6737:Lmtk3 UTSW 7 45793627 missense probably damaging 0.99
R6800:Lmtk3 UTSW 7 45793809 missense possibly damaging 0.91
R7319:Lmtk3 UTSW 7 45794316 missense unknown
R7335:Lmtk3 UTSW 7 45795157 missense unknown
R7353:Lmtk3 UTSW 7 45788000 missense possibly damaging 0.46
R7621:Lmtk3 UTSW 7 45793417 missense probably damaging 1.00
R7699:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7700:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7836:Lmtk3 UTSW 7 45786903 missense possibly damaging 0.89
R7929:Lmtk3 UTSW 7 45795148 missense unknown
R8128:Lmtk3 UTSW 7 45794174 missense
X0052:Lmtk3 UTSW 7 45793498 missense probably benign 0.03
X0067:Lmtk3 UTSW 7 45794680 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACTCTTCCTTGCGTGCAGAG -3'
(R):5'- CTACAAAGGTTGGCTTCTCCTGG -3'

Sequencing Primer
(F):5'- CTCCTTGGCCGACCTGC -3'
(R):5'- TTCTCCTGGGACCCTGGGAG -3'
Posted On2018-09-12