Mutagenetix > Incidental Mutation

Incidental Mutation 'R6856:Aire'

535267

Institutional Source

Beutler Lab

Gene Symbol

Aire

Ensembl Gene

ENSMUSG00000000731

Gene Name

autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6856 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78030022-78043610 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78030255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 546 (F546I)

Ref Sequence

ENSEMBL: ENSMUSP00000120150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019257] [ENSMUST00000105395] [ENSMUST00000105396] [ENSMUST00000128241] [ENSMUST00000130972] [ENSMUST00000131028] [ENSMUST00000140636] [ENSMUST00000143735] [ENSMUST00000145975] [ENSMUST00000148469] [ENSMUST00000154374] [ENSMUST00000155021] [ENSMUST00000156417]

AlphaFold

Q9Z0E3

Predicted Effect

probably damaging
Transcript: ENSMUST00000019257
AA Change: F549I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019257
Gene: ENSMUSG00000000731
AA Change: F549I

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	8.9e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	299	342	6.75e-11	SMART
RING	300	341	3.63e0	SMART
low complexity region	398	419	N/A	INTRINSIC
PHD	432	475	7.82e-7	SMART
RING	433	474	2.49e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105395

SMART Domains

Protein: ENSMUSP00000101034
Gene: ENSMUSG00000000731

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	1.6e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	300	343	6.75e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105396
AA Change: F490I

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101035
Gene: ENSMUSG00000000731
AA Change: F490I

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	2.2e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	299	342	6.75e-11	SMART
RING	300	341	3.63e0	SMART
PHD	373	416	7.82e-7	SMART
RING	374	415	2.49e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000128241
AA Change: F550I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114904
Gene: ENSMUSG00000000731
AA Change: F550I

Domain	Start	End	E-Value	Type
Pfam:Sp100	5	104	3.3e-27	PFAM
SAND	198	264	2.61e-26	SMART
PHD	300	343	6.75e-11	SMART
RING	301	342	3.63e0	SMART
low complexity region	399	420	N/A	INTRINSIC
PHD	433	476	7.82e-7	SMART
RING	434	475	2.49e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130972
AA Change: F545I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122659
Gene: ENSMUSG00000000731
AA Change: F545I

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	2.6e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	295	338	6.75e-11	SMART
RING	296	337	3.63e0	SMART
low complexity region	394	415	N/A	INTRINSIC
PHD	428	471	7.82e-7	SMART
RING	429	470	2.49e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131028

SMART Domains

Protein: ENSMUSP00000114808
Gene: ENSMUSG00000000731

Domain	Start	End	E-Value	Type
Pfam:Sp100	5	57	2.6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140636

SMART Domains

Protein: ENSMUSP00000121477
Gene: ENSMUSG00000000731

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	1.6e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	295	338	6.75e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143735

SMART Domains

Protein: ENSMUSP00000123678
Gene: ENSMUSG00000000731

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	1.1e-34	PFAM
SAND	198	264	2.61e-26	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000145975
AA Change: F546I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120150
Gene: ENSMUSG00000000731
AA Change: F546I

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	2.6e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	296	339	6.75e-11	SMART
RING	297	338	3.63e0	SMART
low complexity region	395	416	N/A	INTRINSIC
PHD	429	472	7.82e-7	SMART
RING	430	471	2.49e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148469

SMART Domains

Protein: ENSMUSP00000118317
Gene: ENSMUSG00000000731

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	1.6e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	296	339	6.75e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000154374
AA Change: F491I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117094
Gene: ENSMUSG00000000731
AA Change: F491I

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	7.4e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	300	343	6.75e-11	SMART
RING	301	342	3.63e0	SMART
PHD	374	417	7.82e-7	SMART
RING	375	416	2.49e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155021
AA Change: F486I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000122190
Gene: ENSMUSG00000000731
AA Change: F486I

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	2.2e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	295	338	6.75e-11	SMART
RING	296	337	3.63e0	SMART
PHD	369	412	7.82e-7	SMART
RING	370	411	2.49e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156417

SMART Domains

Protein: ENSMUSP00000115162
Gene: ENSMUSG00000000731

Domain	Start	End	E-Value	Type
Pfam:Sp100	1	107	1.6e-34	PFAM
SAND	198	264	2.61e-26	SMART
PHD	299	342	6.75e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]
PHENOTYPE: Targeted mutations that inactivate the gene result in immune system dysfunction characterized by multiorgan lymphocytic infiltration and circulating autoantibodies. Whereas one line is fertile, another exhibits male and female sterility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl4	A	G	3: 151,500,118	M156V	probably benign	Het
Ankk1	T	C	9: 49,420,020	E230G	probably benign	Het
Anp32a	A	T	9: 62,372,115	K86N	possibly damaging	Het
Aqp4	T	C	18: 15,399,896	I47V	possibly damaging	Het
Arap3	A	G	18: 37,979,863	V1098A	possibly damaging	Het
Ascc3	T	A	10: 50,749,062	W1652R	probably damaging	Het
Atad2	T	A	15: 58,106,813	H464L	probably damaging	Het
Brca2	C	A	5: 150,540,208	H1146N	possibly damaging	Het
Capn9	G	A	8: 124,597,569	V203M	probably damaging	Het
Ccr6	T	A	17: 8,256,049	S29T	probably benign	Het
Cfap99	G	T	5: 34,310,217		probably null	Het
Cpt1c	C	T	7: 44,959,918	G716S	probably damaging	Het
Dhx29	A	T	13: 112,952,861	Q722L	probably benign	Het
Dmxl1	C	T	18: 49,852,288	R201*	probably null	Het
Dsg2	G	A	18: 20,601,802	G946S	probably damaging	Het
Erg	C	A	16: 95,368,651		probably null	Het
Fam198b	G	T	3: 79,886,141		probably benign	Het
Fbxo32	G	A	15: 58,214,641		probably benign	Het
Glis1	T	G	4: 107,435,879	D66E	probably damaging	Het
Gm21671	A	G	5: 25,950,845	I167T	probably benign	Het
Grm6	A	T	11: 50,859,825	N605I	probably damaging	Het
Gtf3c6	T	C	10: 40,249,672	E183G	probably benign	Het
Herc1	A	G	9: 66,397,898	M861V	probably benign	Het
Igkv12-41	A	T	6: 69,858,529	S80T	probably damaging	Het
Kcnt2	T	C	1: 140,596,004	S1057P	probably damaging	Het
Krt36	T	G	11: 100,103,390	Q287P	probably damaging	Het
Ldhd	A	G	8: 111,630,274	S13P	probably benign	Het
Lmtk3	T	A	7: 45,794,297		probably benign	Het
Lrp2	A	T	2: 69,513,268	F916I	probably damaging	Het
Map4k1	A	T	7: 28,986,834	I92F	probably damaging	Het
Naa25	A	T	5: 121,438,804	K872M	probably damaging	Het
Nek3	C	A	8: 22,129,447	G443V	probably damaging	Het
Noxred1	T	C	12: 87,227,036	E77G	probably benign	Het
Nup210	G	A	6: 91,087,913	Q202*	probably null	Het
Olfr1065	G	T	2: 86,445,907	S25Y	probably benign	Het
Olfr646	A	T	7: 104,106,791	M171L	probably benign	Het
Pax3	A	G	1: 78,132,419	S201P	probably damaging	Het
Pcdhgb5	T	A	18: 37,733,404	Y751N	probably benign	Het
Pign	A	T	1: 105,553,895	L792*	probably null	Het
Pkd1	T	C	17: 24,573,493	F1385L	probably benign	Het
Plxnb2	A	C	15: 89,164,320	C629G	probably benign	Het
Prpsap2	A	T	11: 61,730,271	I328N	probably benign	Het
Prrc2c	A	G	1: 162,682,371	L2317P	probably damaging	Het
Ptgfrn	T	C	3: 101,045,446	D824G	probably damaging	Het
Ptpra	G	A	2: 130,519,381	S204N	probably damaging	Het
Pygm	G	T	19: 6,393,757	G583C	probably damaging	Het
Rap1a	A	G	3: 105,732,068	F92L	probably damaging	Het
Slmap	A	T	14: 26,430,092		probably null	Het
Spdye4c	A	G	2: 128,596,130		probably null	Het
Ssfa2	C	T	2: 79,657,705	R711C	probably damaging	Het
Stk11	C	A	10: 80,128,090	F97L	probably benign	Het
Tbc1d9b	G	A	11: 50,168,746	A992T	probably benign	Het
Tmem232	G	A	17: 65,450,310	T296M	possibly damaging	Het
Trim33	C	T	3: 103,352,049	T1018M	probably damaging	Het
Trpv2	A	C	11: 62,584,615	I285L	probably benign	Het
Usp46	A	G	5: 74,028,934		probably benign	Het
Vmn1r27	T	A	6: 58,215,447	M191L	possibly damaging	Het
Vwf	G	T	6: 125,642,150	E1264*	probably null	Het
Zfp109	A	T	7: 24,229,398	N195K	probably benign	Het
Zfp385b	T	A	2: 77,415,794	L208F	probably damaging	Het
Zfp839	T	A	12: 110,866,761	Y515*	probably null	Het

Other mutations in Aire

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01744:Aire	APN	10	78036723	nonsense	probably null
IGL01969:Aire	APN	10	78042982	missense	probably damaging	1.00
Million	UTSW	10	78037975	missense	probably damaging	1.00
BB008:Aire	UTSW	10	78030296	missense	probably damaging	1.00
BB018:Aire	UTSW	10	78030296	missense	probably damaging	1.00
E0370:Aire	UTSW	10	78042063	missense	probably damaging	1.00
IGL03055:Aire	UTSW	10	78043069	missense	probably damaging	1.00
R0326:Aire	UTSW	10	78042599	missense	probably damaging	1.00
R0675:Aire	UTSW	10	78034493	splice site	probably benign
R1748:Aire	UTSW	10	78043480	missense	probably damaging	0.99
R1754:Aire	UTSW	10	78030290	missense	probably damaging	1.00
R2014:Aire	UTSW	10	78042958	missense	probably damaging	1.00
R2015:Aire	UTSW	10	78042958	missense	probably damaging	1.00
R3800:Aire	UTSW	10	78042055	splice site	probably null
R5424:Aire	UTSW	10	78036719	missense	probably damaging	1.00
R5517:Aire	UTSW	10	78039691	missense	probably benign	0.14
R5983:Aire	UTSW	10	78043069	missense	probably damaging	1.00
R6135:Aire	UTSW	10	78042967	missense	probably damaging	1.00
R7405:Aire	UTSW	10	78034613	missense	probably benign	0.01
R7484:Aire	UTSW	10	78042570	missense	probably damaging	1.00
R7606:Aire	UTSW	10	78037933	missense	probably damaging	1.00
R7931:Aire	UTSW	10	78030296	missense	probably damaging	1.00
R8867:Aire	UTSW	10	78037975	missense	probably damaging	1.00
R8887:Aire	UTSW	10	78034464	missense	probably damaging	0.96
R9115:Aire	UTSW	10	78043475	missense
R9562:Aire	UTSW	10	78035745	missense	probably benign
R9623:Aire	UTSW	10	78037975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACAAAGATCAGGGCCATCTG -3'
(R):5'- CTGGATCAAGAGACCTCCCTTC -3'

Sequencing Primer
(F):5'- ATCTGCAAGCTGAGTCCAG -3'
(R):5'- TTCACTGGCATGTCCCATGGG -3'

Posted On

2018-09-12