Incidental Mutation 'R6856:Krt36'
ID535273
Institutional Source Beutler Lab
Gene Symbol Krt36
Ensembl Gene ENSMUSG00000020916
Gene Namekeratin 36
SynonymsKrt1-22, keratin 5, HRa-1, Krt1-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6856 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100102007-100105626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100103390 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 287 (Q287P)
Ref Sequence ENSEMBL: ENSMUSP00000103039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107416]
Predicted Effect probably damaging
Transcript: ENSMUST00000107416
AA Change: Q287P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: Q287P

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Filament 92 403 4.05e-163 SMART
low complexity region 425 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Krt36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Krt36 APN 11 100102948 missense probably damaging 0.98
IGL01737:Krt36 APN 11 100104120 missense possibly damaging 0.62
IGL02388:Krt36 APN 11 100105164 nonsense probably null
IGL02985:Krt36 APN 11 100103179 missense probably benign 0.32
R0393:Krt36 UTSW 11 100104114 missense possibly damaging 0.91
R0617:Krt36 UTSW 11 100102275 missense probably damaging 1.00
R0930:Krt36 UTSW 11 100103399 missense probably damaging 1.00
R1166:Krt36 UTSW 11 100102828 missense probably benign 0.00
R1201:Krt36 UTSW 11 100104057 missense probably benign 0.22
R1587:Krt36 UTSW 11 100102302 missense probably damaging 1.00
R1750:Krt36 UTSW 11 100104058 missense probably benign 0.00
R1826:Krt36 UTSW 11 100103030 splice site probably benign
R1846:Krt36 UTSW 11 100105548 missense probably damaging 1.00
R2208:Krt36 UTSW 11 100102939 missense probably damaging 0.96
R4303:Krt36 UTSW 11 100103413 missense possibly damaging 0.59
R5140:Krt36 UTSW 11 100103502 missense probably damaging 1.00
R5719:Krt36 UTSW 11 100104161 missense possibly damaging 0.95
R5944:Krt36 UTSW 11 100105313 missense probably benign
R6188:Krt36 UTSW 11 100102420 missense probably benign 0.00
R6271:Krt36 UTSW 11 100104472 nonsense probably null
R6809:Krt36 UTSW 11 100105509 missense probably benign 0.00
R7153:Krt36 UTSW 11 100105146 nonsense probably null
R7602:Krt36 UTSW 11 100102960 missense probably benign 0.00
R7822:Krt36 UTSW 11 100104140 missense possibly damaging 0.86
R7894:Krt36 UTSW 11 100105235 missense probably damaging 1.00
R7977:Krt36 UTSW 11 100105235 missense probably damaging 1.00
Z1088:Krt36 UTSW 11 100104189 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCGATCTCCAGGGAGTTGACTG -3'
(R):5'- GAACCTTTCCACAGCCTCATG -3'

Sequencing Primer
(F):5'- GACTGTGCGTCTCAGCTCAATG -3'
(R):5'- TATCTTACTTGGCCACTGCAGGAAG -3'
Posted On2018-09-12