Incidental Mutation 'R6856:Aqp4'
ID535285
Institutional Source Beutler Lab
Gene Symbol Aqp4
Ensembl Gene ENSMUSG00000024411
Gene Nameaquaporin 4
Synonymsaquaporin-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6856 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location15389394-15403684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15399896 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 47 (I47V)
Ref Sequence ENSEMBL: ENSMUSP00000078088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079081
AA Change: I47V

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078088
Gene: ENSMUSG00000024411
AA Change: I47V

DomainStartEndE-ValueType
Pfam:MIP 29 248 8.7e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit decreased urine osmolality associated with reduced water permeability in inner medullary collecting ducts, increased survival rates and reduced brain edema after acute water intoxication and ischemic stroke, aswell as significant hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Aqp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Aqp4 APN 18 15393599 missense probably benign 0.01
IGL01700:Aqp4 APN 18 15399865 missense probably benign 0.44
IGL02409:Aqp4 APN 18 15399725 missense probably benign 0.02
IGL02812:Aqp4 APN 18 15397575 splice site probably null
IGL03157:Aqp4 APN 18 15399980 missense probably benign 0.18
IGL03196:Aqp4 APN 18 15393509 missense probably benign 0.19
R0358:Aqp4 UTSW 18 15398245 missense probably benign
R1061:Aqp4 UTSW 18 15398191 missense probably damaging 1.00
R1981:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R1982:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R2274:Aqp4 UTSW 18 15393480 missense probably benign
R3033:Aqp4 UTSW 18 15393560 missense possibly damaging 0.80
R4608:Aqp4 UTSW 18 15398126 missense probably benign 0.25
R4817:Aqp4 UTSW 18 15399758 missense probably damaging 1.00
R4882:Aqp4 UTSW 18 15398254 missense possibly damaging 0.73
R5870:Aqp4 UTSW 18 15399889 missense probably damaging 1.00
R6235:Aqp4 UTSW 18 15398113 missense probably damaging 1.00
R6334:Aqp4 UTSW 18 15393591 missense probably benign
R7753:Aqp4 UTSW 18 15399976 missense probably benign 0.00
R7839:Aqp4 UTSW 18 15399680 missense possibly damaging 0.51
R8191:Aqp4 UTSW 18 15398165 missense probably benign
R8206:Aqp4 UTSW 18 15393659 missense possibly damaging 0.88
R8759:Aqp4 UTSW 18 15399991 missense probably benign
T0970:Aqp4 UTSW 18 15399883 missense probably damaging 1.00
Z1177:Aqp4 UTSW 18 15399881 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTACAGTCACAGCGGGATTG -3'
(R):5'- GTGTTCAGCAAACCATCGCC -3'

Sequencing Primer
(F):5'- CGGGATTGATGTGGCCAC -3'
(R):5'- CCCAGATTTCAATGTGCCTTCCAG -3'
Posted On2018-09-12