Incidental Mutation 'R6857:Plxnd1'
ID535314
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Nameplexin D1
Synonymsb2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6857 (G1)
Quality Score224.009
Status Validated
Chromosome6
Chromosomal Location115954811-115995005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115993763 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 348 (A348E)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
Predicted Effect probably benign
Transcript: ENSMUST00000015511
AA Change: A348E

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: A348E

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,432,102 H107Q probably benign Het
Abca6 A G 11: 110,219,688 L545P possibly damaging Het
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Ahnak C T 19: 9,037,168 Q119* probably null Het
AI314180 T A 4: 58,814,065 D1347V probably damaging Het
Anxa10 C A 8: 62,061,017 A239S probably benign Het
B020011L13Rik A T 1: 117,801,288 H175L probably benign Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Best2 A G 8: 85,007,823 V422A probably benign Het
Cc2d2b T C 19: 40,770,865 F298S possibly damaging Het
Cd38 T A 5: 43,906,198 M211K probably damaging Het
Cd3d T G 9: 44,985,604 M92R probably damaging Het
Cdk5rap2 C A 4: 70,245,396 E1474* probably null Het
Clvs1 A G 4: 9,449,433 K341E probably benign Het
Copg2 G T 6: 30,863,598 D112E possibly damaging Het
Dmxl1 A T 18: 49,864,835 N697Y probably damaging Het
Dync1h1 T C 12: 110,658,547 S3803P possibly damaging Het
Epx T A 11: 87,869,955 K384* probably null Het
Fam135a G C 1: 24,014,789 D1222E probably damaging Het
Fndc1 T A 17: 7,772,170 H898L unknown Het
Gapvd1 A G 2: 34,728,377 I190T probably damaging Het
Gm14139 G T 2: 150,192,062 C132F probably damaging Het
Hax1 T G 3: 89,997,452 S122R probably damaging Het
Hdac9 T G 12: 34,393,363 M272L probably benign Het
Itgb7 T C 15: 102,223,465 S228G probably damaging Het
Itpr2 C A 6: 146,397,019 E315* probably null Het
Kctd8 T C 5: 69,296,702 N331D probably benign Het
Ky G A 9: 102,542,432 G546E probably damaging Het
Lao1 T C 4: 118,963,826 probably null Het
Mtmr12 T A 15: 12,263,832 W427R probably damaging Het
Mxra8 A G 4: 155,843,136 K434E possibly damaging Het
Myh4 T C 11: 67,249,885 C676R possibly damaging Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Olfr1082 A T 2: 86,594,264 L188H probably damaging Het
Olfr1141 A T 2: 87,753,487 C169S probably damaging Het
Olfr914 T C 9: 38,607,011 L182P probably benign Het
Paqr5 G T 9: 61,976,088 H41N probably damaging Het
Plekha8 T C 6: 54,629,935 L405P probably damaging Het
Plpbp A G 8: 27,045,426 N79S possibly damaging Het
Prdm9 T C 17: 15,544,256 Q754R probably benign Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rgs12 A T 5: 35,030,022 K213* probably null Het
Serpina3m T C 12: 104,389,326 L84P probably damaging Het
Tab2 T C 10: 7,920,413 T102A possibly damaging Het
Tagln3 G T 16: 45,724,236 A24E probably benign Het
Tanc2 A G 11: 105,910,288 E1110G possibly damaging Het
Tcf3 T C 10: 80,416,899 probably null Het
Tmem14a T C 1: 21,229,545 probably benign Het
Ttn T A 2: 76,917,931 E4258V possibly damaging Het
Ubr4 G A 4: 139,486,051 D5104N possibly damaging Het
Ugt2b37 C G 5: 87,240,846 A503P probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r88 A T 7: 13,178,331 M205L possibly damaging Het
Vmn2r109 C T 17: 20,540,670 M808I probably benign Het
Wdr72 G T 9: 74,155,041 V490L probably damaging Het
Zgrf1 T A 3: 127,581,447 V785E probably damaging Het
Zswim7 A T 11: 62,281,129 probably benign Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACCTGTATGTTGCGCTTGC -3'
(R):5'- CGTCGGACGATAACATCCTG -3'

Sequencing Primer
(F):5'- TGCCCTGCACCACACTG -3'
(R):5'- GTCGGACGATAACATCCTGAAGATC -3'
Posted On2018-09-12