Incidental Mutation 'R6857:Olfr914'
ID535320
Institutional Source Beutler Lab
Gene Symbol Olfr914
Ensembl Gene ENSMUSG00000047050
Gene Nameolfactory receptor 914
SynonymsMOR165-7, GA_x6K02T2PVTD-32308823-32309773
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6857 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38605102-38610978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38607011 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 182 (L182P)
Ref Sequence ENSEMBL: ENSMUSP00000150241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057755] [ENSMUST00000217057]
Predicted Effect probably benign
Transcript: ENSMUST00000057755
AA Change: L182P

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053405
Gene: ENSMUSG00000047050
AA Change: L182P

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 1.1e-48 PFAM
Pfam:7tm_1 41 290 5.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217057
AA Change: L182P

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,432,102 H107Q probably benign Het
Abca6 A G 11: 110,219,688 L545P possibly damaging Het
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Ahnak C T 19: 9,037,168 Q119* probably null Het
AI314180 T A 4: 58,814,065 D1347V probably damaging Het
Anxa10 C A 8: 62,061,017 A239S probably benign Het
B020011L13Rik A T 1: 117,801,288 H175L probably benign Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Best2 A G 8: 85,007,823 V422A probably benign Het
Cc2d2b T C 19: 40,770,865 F298S possibly damaging Het
Cd38 T A 5: 43,906,198 M211K probably damaging Het
Cd3d T G 9: 44,985,604 M92R probably damaging Het
Cdk5rap2 C A 4: 70,245,396 E1474* probably null Het
Clvs1 A G 4: 9,449,433 K341E probably benign Het
Copg2 G T 6: 30,863,598 D112E possibly damaging Het
Dmxl1 A T 18: 49,864,835 N697Y probably damaging Het
Dync1h1 T C 12: 110,658,547 S3803P possibly damaging Het
Epx T A 11: 87,869,955 K384* probably null Het
Fam135a G C 1: 24,014,789 D1222E probably damaging Het
Fndc1 T A 17: 7,772,170 H898L unknown Het
Gapvd1 A G 2: 34,728,377 I190T probably damaging Het
Gm14139 G T 2: 150,192,062 C132F probably damaging Het
Hax1 T G 3: 89,997,452 S122R probably damaging Het
Hdac9 T G 12: 34,393,363 M272L probably benign Het
Itgb7 T C 15: 102,223,465 S228G probably damaging Het
Itpr2 C A 6: 146,397,019 E315* probably null Het
Kctd8 T C 5: 69,296,702 N331D probably benign Het
Ky G A 9: 102,542,432 G546E probably damaging Het
Lao1 T C 4: 118,963,826 probably null Het
Mtmr12 T A 15: 12,263,832 W427R probably damaging Het
Mxra8 A G 4: 155,843,136 K434E possibly damaging Het
Myh4 T C 11: 67,249,885 C676R possibly damaging Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Olfr1082 A T 2: 86,594,264 L188H probably damaging Het
Olfr1141 A T 2: 87,753,487 C169S probably damaging Het
Paqr5 G T 9: 61,976,088 H41N probably damaging Het
Plekha8 T C 6: 54,629,935 L405P probably damaging Het
Plpbp A G 8: 27,045,426 N79S possibly damaging Het
Plxnd1 G T 6: 115,993,763 A348E probably benign Het
Prdm9 T C 17: 15,544,256 Q754R probably benign Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rgs12 A T 5: 35,030,022 K213* probably null Het
Serpina3m T C 12: 104,389,326 L84P probably damaging Het
Tab2 T C 10: 7,920,413 T102A possibly damaging Het
Tagln3 G T 16: 45,724,236 A24E probably benign Het
Tanc2 A G 11: 105,910,288 E1110G possibly damaging Het
Tcf3 T C 10: 80,416,899 probably null Het
Tmem14a T C 1: 21,229,545 probably benign Het
Ttn T A 2: 76,917,931 E4258V possibly damaging Het
Ubr4 G A 4: 139,486,051 D5104N possibly damaging Het
Ugt2b37 C G 5: 87,240,846 A503P probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r88 A T 7: 13,178,331 M205L possibly damaging Het
Vmn2r109 C T 17: 20,540,670 M808I probably benign Het
Wdr72 G T 9: 74,155,041 V490L probably damaging Het
Zgrf1 T A 3: 127,581,447 V785E probably damaging Het
Zswim7 A T 11: 62,281,129 probably benign Het
Other mutations in Olfr914
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr914 APN 9 38606554 missense probably null 0.00
IGL01758:Olfr914 APN 9 38607293 missense probably damaging 0.99
IGL02003:Olfr914 APN 9 38606840 missense probably damaging 1.00
IGL02203:Olfr914 APN 9 38607423 utr 3 prime probably benign
IGL02233:Olfr914 APN 9 38607242 missense probably damaging 1.00
IGL02408:Olfr914 APN 9 38607121 missense possibly damaging 0.62
IGL02882:Olfr914 APN 9 38606938 missense probably benign 0.04
IGL03081:Olfr914 APN 9 38606870 missense probably benign 0.01
IGL03088:Olfr914 APN 9 38607301 missense probably damaging 0.99
IGL03177:Olfr914 APN 9 38606571 nonsense probably null
IGL03219:Olfr914 APN 9 38606951 missense probably benign 0.28
P0023:Olfr914 UTSW 9 38606645 missense probably damaging 1.00
R0630:Olfr914 UTSW 9 38606896 missense probably benign 0.01
R0948:Olfr914 UTSW 9 38606491 missense possibly damaging 0.65
R1451:Olfr914 UTSW 9 38606938 missense probably benign 0.04
R1681:Olfr914 UTSW 9 38606948 missense probably damaging 0.99
R2402:Olfr914 UTSW 9 38607101 missense probably benign 0.02
R5854:Olfr914 UTSW 9 38606663 missense probably damaging 1.00
R7452:Olfr914 UTSW 9 38607088 missense probably benign 0.34
R7838:Olfr914 UTSW 9 38606412 start gained probably benign
R7921:Olfr914 UTSW 9 38606412 start gained probably benign
R8039:Olfr914 UTSW 9 38607389 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAATGTTATGTGCTGACAGC -3'
(R):5'- ATGTGGGAACTGCAAGTGCTG -3'

Sequencing Primer
(F):5'- CAGCAATGGCCTATGATCGCTATG -3'
(R):5'- CAAGTGCTGAAGGCTTTGGACC -3'
Posted On2018-09-12