Incidental Mutation 'R6857:Tanc2'
ID535329
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6857 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105910288 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1110 (E1110G)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect
SMART Domains Protein: ENSMUSP00000086912
Gene: ENSMUSG00000053580
AA Change: E154G

DomainStartEndE-ValueType
ANK 35 63 1.16e3 SMART
ANK 78 107 3.31e-1 SMART
ANK 111 140 7.71e-2 SMART
ANK 144 173 6.12e-5 SMART
ANK 177 206 8.99e-3 SMART
ANK 210 239 5.71e-5 SMART
ANK 243 272 2.11e2 SMART
Blast:TPR 289 322 3e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000100330
AA Change: E1110G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: E1110G

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123674
Gene: ENSMUSG00000053580
AA Change: E242G

DomainStartEndE-ValueType
ANK 15 46 2.97e2 SMART
ANK 50 79 5.75e-1 SMART
ANK 83 112 8.62e1 SMART
ANK 123 151 1.16e3 SMART
ANK 166 195 3.31e-1 SMART
ANK 199 228 7.71e-2 SMART
ANK 232 261 6.12e-5 SMART
ANK 265 294 8.99e-3 SMART
ANK 298 327 5.71e-5 SMART
ANK 331 360 3.44e1 SMART
TPR 387 420 3.89e1 SMART
TPR 434 467 3.61e-2 SMART
TPR 468 501 2.82e-4 SMART
low complexity region 512 549 N/A INTRINSIC
low complexity region 676 682 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
Meta Mutation Damage Score 0.2843 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,432,102 H107Q probably benign Het
Abca6 A G 11: 110,219,688 L545P possibly damaging Het
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Ahnak C T 19: 9,037,168 Q119* probably null Het
AI314180 T A 4: 58,814,065 D1347V probably damaging Het
Anxa10 C A 8: 62,061,017 A239S probably benign Het
B020011L13Rik A T 1: 117,801,288 H175L probably benign Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Best2 A G 8: 85,007,823 V422A probably benign Het
Cc2d2b T C 19: 40,770,865 F298S possibly damaging Het
Cd38 T A 5: 43,906,198 M211K probably damaging Het
Cd3d T G 9: 44,985,604 M92R probably damaging Het
Cdk5rap2 C A 4: 70,245,396 E1474* probably null Het
Clvs1 A G 4: 9,449,433 K341E probably benign Het
Copg2 G T 6: 30,863,598 D112E possibly damaging Het
Dmxl1 A T 18: 49,864,835 N697Y probably damaging Het
Dync1h1 T C 12: 110,658,547 S3803P possibly damaging Het
Epx T A 11: 87,869,955 K384* probably null Het
Fam135a G C 1: 24,014,789 D1222E probably damaging Het
Fndc1 T A 17: 7,772,170 H898L unknown Het
Gapvd1 A G 2: 34,728,377 I190T probably damaging Het
Gm14139 G T 2: 150,192,062 C132F probably damaging Het
Hax1 T G 3: 89,997,452 S122R probably damaging Het
Hdac9 T G 12: 34,393,363 M272L probably benign Het
Itgb7 T C 15: 102,223,465 S228G probably damaging Het
Itpr2 C A 6: 146,397,019 E315* probably null Het
Kctd8 T C 5: 69,296,702 N331D probably benign Het
Ky G A 9: 102,542,432 G546E probably damaging Het
Lao1 T C 4: 118,963,826 probably null Het
Mtmr12 T A 15: 12,263,832 W427R probably damaging Het
Mxra8 A G 4: 155,843,136 K434E possibly damaging Het
Myh4 T C 11: 67,249,885 C676R possibly damaging Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Olfr1082 A T 2: 86,594,264 L188H probably damaging Het
Olfr1141 A T 2: 87,753,487 C169S probably damaging Het
Olfr914 T C 9: 38,607,011 L182P probably benign Het
Paqr5 G T 9: 61,976,088 H41N probably damaging Het
Plekha8 T C 6: 54,629,935 L405P probably damaging Het
Plpbp A G 8: 27,045,426 N79S possibly damaging Het
Plxnd1 G T 6: 115,993,763 A348E probably benign Het
Prdm9 T C 17: 15,544,256 Q754R probably benign Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rgs12 A T 5: 35,030,022 K213* probably null Het
Serpina3m T C 12: 104,389,326 L84P probably damaging Het
Tab2 T C 10: 7,920,413 T102A possibly damaging Het
Tagln3 G T 16: 45,724,236 A24E probably benign Het
Tcf3 T C 10: 80,416,899 probably null Het
Tmem14a T C 1: 21,229,545 probably benign Het
Ttn T A 2: 76,917,931 E4258V possibly damaging Het
Ubr4 G A 4: 139,486,051 D5104N possibly damaging Het
Ugt2b37 C G 5: 87,240,846 A503P probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r88 A T 7: 13,178,331 M205L possibly damaging Het
Vmn2r109 C T 17: 20,540,670 M808I probably benign Het
Wdr72 G T 9: 74,155,041 V490L probably damaging Het
Zgrf1 T A 3: 127,581,447 V785E probably damaging Het
Zswim7 A T 11: 62,281,129 probably benign Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 intron probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105776858 missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105867654 missense probably benign 0.00
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGTAGTTCACGCTGTAGGAGAG -3'
(R):5'- GCAGGAGCATCTGGTTTTGC -3'

Sequencing Primer
(F):5'- GAGTGCATACATGTGTCATCTCAGC -3'
(R):5'- TTTGAACTCAGGACCTCTGGAAG -3'
Posted On2018-09-12