Mutagenetix > Incidental Mutations

Incidental Mutation 'R6857:Vmn2r109'

535342

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R6857 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20540670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 808 (M808I)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

AlphaFold

K7N747

Predicted Effect

probably benign
Transcript: ENSMUST00000167093
AA Change: M808I

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: M808I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	T	13: 66,432,102	H107Q	probably benign	Het
Abca6	A	G	11: 110,219,688	L545P	possibly damaging	Het
Adam4	T	C	12: 81,419,949	T633A	possibly damaging	Het
Ahnak	C	T	19: 9,037,168	Q119*	probably null	Het
AI314180	T	A	4: 58,814,065	D1347V	probably damaging	Het
Anxa10	C	A	8: 62,061,017	A239S	probably benign	Het
B020011L13Rik	A	T	1: 117,801,288	H175L	probably benign	Het
BC067074	A	T	13: 113,319,958	N846I	probably damaging	Het
Best2	A	G	8: 85,007,823	V422A	probably benign	Het
Cc2d2b	T	C	19: 40,770,865	F298S	possibly damaging	Het
Cd38	T	A	5: 43,906,198	M211K	probably damaging	Het
Cd3d	T	G	9: 44,985,604	M92R	probably damaging	Het
Cdk5rap2	C	A	4: 70,245,396	E1474*	probably null	Het
Clvs1	A	G	4: 9,449,433	K341E	probably benign	Het
Copg2	G	T	6: 30,863,598	D112E	possibly damaging	Het
Dmxl1	A	T	18: 49,864,835	N697Y	probably damaging	Het
Dync1h1	T	C	12: 110,658,547	S3803P	possibly damaging	Het
Epx	T	A	11: 87,869,955	K384*	probably null	Het
Fam135a	G	C	1: 24,014,789	D1222E	probably damaging	Het
Fndc1	T	A	17: 7,772,170	H898L	unknown	Het
Gapvd1	A	G	2: 34,728,377	I190T	probably damaging	Het
Gm14139	G	T	2: 150,192,062	C132F	probably damaging	Het
Hax1	T	G	3: 89,997,452	S122R	probably damaging	Het
Hdac9	T	G	12: 34,393,363	M272L	probably benign	Het
Itgb7	T	C	15: 102,223,465	S228G	probably damaging	Het
Itpr2	C	A	6: 146,397,019	E315*	probably null	Het
Kctd8	T	C	5: 69,296,702	N331D	probably benign	Het
Ky	G	A	9: 102,542,432	G546E	probably damaging	Het
Lao1	T	C	4: 118,963,826		probably null	Het
Mtmr12	T	A	15: 12,263,832	W427R	probably damaging	Het
Mxra8	A	G	4: 155,843,136	K434E	possibly damaging	Het
Myh4	T	C	11: 67,249,885	C676R	possibly damaging	Het
Nek7	C	T	1: 138,515,682	G178R	probably damaging	Het
Olfr1082	A	T	2: 86,594,264	L188H	probably damaging	Het
Olfr1141	A	T	2: 87,753,487	C169S	probably damaging	Het
Olfr914	T	C	9: 38,607,011	L182P	probably benign	Het
Paqr5	G	T	9: 61,976,088	H41N	probably damaging	Het
Plekha8	T	C	6: 54,629,935	L405P	probably damaging	Het
Plpbp	A	G	8: 27,045,426	N79S	possibly damaging	Het
Plxnd1	G	T	6: 115,993,763	A348E	probably benign	Het
Prdm9	T	C	17: 15,544,256	Q754R	probably benign	Het
Pygm	G	T	19: 6,393,757	G583C	probably damaging	Het
Rgs12	A	T	5: 35,030,022	K213*	probably null	Het
Serpina3m	T	C	12: 104,389,326	L84P	probably damaging	Het
Tab2	T	C	10: 7,920,413	T102A	possibly damaging	Het
Tagln3	G	T	16: 45,724,236	A24E	probably benign	Het
Tanc2	A	G	11: 105,910,288	E1110G	possibly damaging	Het
Tcf3	T	C	10: 80,416,899		probably null	Het
Tmem14a	T	C	1: 21,229,545		probably benign	Het
Ttn	T	A	2: 76,917,931	E4258V	possibly damaging	Het
Ubr4	G	A	4: 139,486,051	D5104N	possibly damaging	Het
Ugt2b37	C	G	5: 87,240,846	A503P	probably damaging	Het
Unc45b	A	G	11: 82,913,212	I72V	probably benign	Het
Vmn1r88	A	T	7: 13,178,331	M205L	possibly damaging	Het
Wdr72	G	T	9: 74,155,041	V490L	probably damaging	Het
Zgrf1	T	A	3: 127,581,447	V785E	probably damaging	Het
Zswim7	A	T	11: 62,281,129		probably benign	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1587:Vmn2r109	UTSW	17	20540740	missense	probably damaging	1.00
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R2436:Vmn2r109	UTSW	17	20554536	missense	probably damaging	0.99
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R5832:Vmn2r109	UTSW	17	20541056	missense	probably benign	0.10
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6334:Vmn2r109	UTSW	17	20541178	missense	probably benign	0.18
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6953:Vmn2r109	UTSW	17	20540711	missense	possibly damaging	0.95
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7596:Vmn2r109	UTSW	17	20540680	missense	probably damaging	0.98
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7859:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R8113:Vmn2r109	UTSW	17	20554467	missense	probably benign	0.01
R8153:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R8977:Vmn2r109	UTSW	17	20554269	missense	possibly damaging	0.96
Z1176:Vmn2r109	UTSW	17	20552994	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGATCAAGAGAGCATATGTGGTTTTC -3'
(R):5'- AGGGATCATCTGTTGCCTTCC -3'

Sequencing Primer
(F):5'- TGACATATGTTTACAATGGAATAGGG -3'
(R):5'- TTCCACTGTGTTCTGGGATAC -3'

Posted On

2018-09-12