Mutagenetix > Incidental Mutations

Incidental Mutation 'R6857:Dmxl1'

535343

Institutional Source

Beutler Lab

Gene Symbol

Dmxl1

Ensembl Gene

ENSMUSG00000037416

Gene Name

Dmx-like 1

Synonyms

C630007L23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R6857 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49832670-49965473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 49864835 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 697 (N697Y)

Ref Sequence

ENSEMBL: ENSMUSP00000045559 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041772
AA Change: N697Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: N697Y

Domain	Start	End	E-Value	Type
WD40	100	136	8.22e1	SMART
WD40	156	195	2.88e-1	SMART
WD40	218	266	8.29e-1	SMART
low complexity region	367	378	N/A	INTRINSIC
WD40	464	505	1.53e2	SMART
Blast:WD40	719	772	1e-25	BLAST
WD40	957	999	1.1e1	SMART
Pfam:Rav1p_C	1102	1877	4.3e-84	PFAM
low complexity region	1922	1942	N/A	INTRINSIC
low complexity region	1966	1975	N/A	INTRINSIC
low complexity region	1993	2007	N/A	INTRINSIC
low complexity region	2147	2158	N/A	INTRINSIC
low complexity region	2371	2385	N/A	INTRINSIC
low complexity region	2397	2410	N/A	INTRINSIC
low complexity region	2449	2466	N/A	INTRINSIC
WD40	2735	2770	1.07e1	SMART
WD40	2773	2813	3.7e0	SMART
WD40	2825	2867	1.07e0	SMART
WD40	2873	2912	1.05e-2	SMART
WD40	2915	2954	4.51e-7	SMART
Blast:WD40	2957	3005	9e-26	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000180611
AA Change: N697Y

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: N697Y

Domain	Start	End	E-Value	Type
WD40	100	136	8.22e1	SMART
WD40	156	195	2.88e-1	SMART
WD40	218	266	8.29e-1	SMART
low complexity region	367	378	N/A	INTRINSIC
WD40	464	505	1.53e2	SMART
Blast:WD40	719	772	1e-25	BLAST
WD40	957	999	1.1e1	SMART
low complexity region	1195	1206	N/A	INTRINSIC
low complexity region	1258	1271	N/A	INTRINSIC
Pfam:Rav1p_C	1287	1876	9.4e-72	PFAM
low complexity region	1922	1942	N/A	INTRINSIC
low complexity region	1966	1975	N/A	INTRINSIC
low complexity region	1993	2007	N/A	INTRINSIC
low complexity region	2147	2158	N/A	INTRINSIC
low complexity region	2385	2398	N/A	INTRINSIC
low complexity region	2437	2454	N/A	INTRINSIC
WD40	2723	2758	1.07e1	SMART
WD40	2761	2801	3.7e0	SMART
WD40	2813	2855	1.07e0	SMART
WD40	2861	2900	1.05e-2	SMART
WD40	2903	2942	4.51e-7	SMART
Blast:WD40	2945	2993	9e-26	BLAST

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	T	13: 66,432,102	H107Q	probably benign	Het
Abca6	A	G	11: 110,219,688	L545P	possibly damaging	Het
Adam4	T	C	12: 81,419,949	T633A	possibly damaging	Het
Ahnak	C	T	19: 9,037,168	Q119*	probably null	Het
AI314180	T	A	4: 58,814,065	D1347V	probably damaging	Het
Anxa10	C	A	8: 62,061,017	A239S	probably benign	Het
B020011L13Rik	A	T	1: 117,801,288	H175L	probably benign	Het
BC067074	A	T	13: 113,319,958	N846I	probably damaging	Het
Best2	A	G	8: 85,007,823	V422A	probably benign	Het
Cc2d2b	T	C	19: 40,770,865	F298S	possibly damaging	Het
Cd38	T	A	5: 43,906,198	M211K	probably damaging	Het
Cd3d	T	G	9: 44,985,604	M92R	probably damaging	Het
Cdk5rap2	C	A	4: 70,245,396	E1474*	probably null	Het
Clvs1	A	G	4: 9,449,433	K341E	probably benign	Het
Copg2	G	T	6: 30,863,598	D112E	possibly damaging	Het
Dync1h1	T	C	12: 110,658,547	S3803P	possibly damaging	Het
Epx	T	A	11: 87,869,955	K384*	probably null	Het
Fam135a	G	C	1: 24,014,789	D1222E	probably damaging	Het
Fndc1	T	A	17: 7,772,170	H898L	unknown	Het
Gapvd1	A	G	2: 34,728,377	I190T	probably damaging	Het
Gm14139	G	T	2: 150,192,062	C132F	probably damaging	Het
Hax1	T	G	3: 89,997,452	S122R	probably damaging	Het
Hdac9	T	G	12: 34,393,363	M272L	probably benign	Het
Itgb7	T	C	15: 102,223,465	S228G	probably damaging	Het
Itpr2	C	A	6: 146,397,019	E315*	probably null	Het
Kctd8	T	C	5: 69,296,702	N331D	probably benign	Het
Ky	G	A	9: 102,542,432	G546E	probably damaging	Het
Lao1	T	C	4: 118,963,826		probably null	Het
Mtmr12	T	A	15: 12,263,832	W427R	probably damaging	Het
Mxra8	A	G	4: 155,843,136	K434E	possibly damaging	Het
Myh4	T	C	11: 67,249,885	C676R	possibly damaging	Het
Nek7	C	T	1: 138,515,682	G178R	probably damaging	Het
Olfr1082	A	T	2: 86,594,264	L188H	probably damaging	Het
Olfr1141	A	T	2: 87,753,487	C169S	probably damaging	Het
Olfr914	T	C	9: 38,607,011	L182P	probably benign	Het
Paqr5	G	T	9: 61,976,088	H41N	probably damaging	Het
Plekha8	T	C	6: 54,629,935	L405P	probably damaging	Het
Plpbp	A	G	8: 27,045,426	N79S	possibly damaging	Het
Plxnd1	G	T	6: 115,993,763	A348E	probably benign	Het
Prdm9	T	C	17: 15,544,256	Q754R	probably benign	Het
Pygm	G	T	19: 6,393,757	G583C	probably damaging	Het
Rgs12	A	T	5: 35,030,022	K213*	probably null	Het
Serpina3m	T	C	12: 104,389,326	L84P	probably damaging	Het
Tab2	T	C	10: 7,920,413	T102A	possibly damaging	Het
Tagln3	G	T	16: 45,724,236	A24E	probably benign	Het
Tanc2	A	G	11: 105,910,288	E1110G	possibly damaging	Het
Tcf3	T	C	10: 80,416,899		probably null	Het
Tmem14a	T	C	1: 21,229,545		probably benign	Het
Ttn	T	A	2: 76,917,931	E4258V	possibly damaging	Het
Ubr4	G	A	4: 139,486,051	D5104N	possibly damaging	Het
Ugt2b37	C	G	5: 87,240,846	A503P	probably damaging	Het
Unc45b	A	G	11: 82,913,212	I72V	probably benign	Het
Vmn1r88	A	T	7: 13,178,331	M205L	possibly damaging	Het
Vmn2r109	C	T	17: 20,540,670	M808I	probably benign	Het
Wdr72	G	T	9: 74,155,041	V490L	probably damaging	Het
Zgrf1	T	A	3: 127,581,447	V785E	probably damaging	Het
Zswim7	A	T	11: 62,281,129		probably benign	Het

Other mutations in Dmxl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Dmxl1	APN	18	49851467	missense	probably damaging	1.00
IGL00668:Dmxl1	APN	18	49939553	missense	possibly damaging	0.64
IGL00740:Dmxl1	APN	18	49917668	missense	probably benign	0.00
IGL00969:Dmxl1	APN	18	49912725	missense	probably benign	0.02
IGL01113:Dmxl1	APN	18	49912751	missense	probably benign	0.01
IGL01384:Dmxl1	APN	18	49857334	missense	probably benign
IGL01475:Dmxl1	APN	18	49871714	missense	probably damaging	1.00
IGL01559:Dmxl1	APN	18	49920938	missense	probably damaging	0.99
IGL01578:Dmxl1	APN	18	49962205	missense	probably damaging	1.00
IGL01632:Dmxl1	APN	18	49863025	missense	probably damaging	0.99
IGL01814:Dmxl1	APN	18	49864868	missense	probably damaging	1.00
IGL01843:Dmxl1	APN	18	49878382	nonsense	probably null
IGL01933:Dmxl1	APN	18	49877785	missense	probably benign	0.17
IGL01952:Dmxl1	APN	18	49890654	missense	probably benign	0.11
IGL02120:Dmxl1	APN	18	49894178	missense	possibly damaging	0.83
IGL02162:Dmxl1	APN	18	49961163	missense	probably benign	0.00
IGL02213:Dmxl1	APN	18	49877674	splice site	probably benign
IGL02261:Dmxl1	APN	18	49840499	missense	possibly damaging	0.85
IGL02689:Dmxl1	APN	18	49864895	missense	probably damaging	1.00
IGL02892:Dmxl1	APN	18	49859120	missense	probably damaging	0.96
IGL03232:Dmxl1	APN	18	49878180	missense	probably benign	0.01
IGL03258:Dmxl1	APN	18	49920893	missense	probably damaging	1.00
IGL03298:Dmxl1	APN	18	49864818	missense	probably benign
hibiscus	UTSW	18	49889467	missense	probably damaging	1.00
pitcher	UTSW	18	49864148	missense	probably damaging	1.00
PIT4810001:Dmxl1	UTSW	18	49931963	missense	probably damaging	1.00
R0001:Dmxl1	UTSW	18	49888897	splice site	probably benign
R0027:Dmxl1	UTSW	18	49957295	splice site	probably benign
R0042:Dmxl1	UTSW	18	49864035	missense	probably benign	0.03
R0042:Dmxl1	UTSW	18	49864035	missense	probably benign	0.03
R0046:Dmxl1	UTSW	18	49878082	missense	probably benign	0.22
R0046:Dmxl1	UTSW	18	49878082	missense	probably benign	0.22
R0257:Dmxl1	UTSW	18	49955803	splice site	probably benign
R0349:Dmxl1	UTSW	18	49879282	missense	probably damaging	0.99
R0390:Dmxl1	UTSW	18	49879362	missense	probably benign	0.14
R0511:Dmxl1	UTSW	18	49891467	nonsense	probably null
R0539:Dmxl1	UTSW	18	49857430	splice site	probably benign
R0542:Dmxl1	UTSW	18	49893694	missense	probably benign	0.05
R0587:Dmxl1	UTSW	18	49935307	missense	probably benign	0.39
R0635:Dmxl1	UTSW	18	49851423	splice site	probably benign
R0744:Dmxl1	UTSW	18	49833148	missense	probably damaging	1.00
R0836:Dmxl1	UTSW	18	49833148	missense	probably damaging	1.00
R0845:Dmxl1	UTSW	18	49893402	missense	probably damaging	1.00
R1218:Dmxl1	UTSW	18	49893611	missense	probably damaging	1.00
R1278:Dmxl1	UTSW	18	49893225	missense	probably benign
R1313:Dmxl1	UTSW	18	49878483	missense	probably damaging	1.00
R1313:Dmxl1	UTSW	18	49878483	missense	probably damaging	1.00
R1349:Dmxl1	UTSW	18	49888853	missense	probably damaging	1.00
R1453:Dmxl1	UTSW	18	49857249	missense	probably benign	0.05
R1522:Dmxl1	UTSW	18	49852367	missense	probably benign	0.05
R1629:Dmxl1	UTSW	18	49859286	critical splice donor site	probably null
R1638:Dmxl1	UTSW	18	49890767	nonsense	probably null
R1646:Dmxl1	UTSW	18	49962261	missense	probably damaging	1.00
R1719:Dmxl1	UTSW	18	49934637	missense	probably damaging	1.00
R1732:Dmxl1	UTSW	18	49893444	nonsense	probably null
R1732:Dmxl1	UTSW	18	49902988	missense	probably benign
R1886:Dmxl1	UTSW	18	49859135	missense	probably benign	0.09
R1887:Dmxl1	UTSW	18	49859135	missense	probably benign	0.09
R1895:Dmxl1	UTSW	18	49955914	splice site	probably null
R1911:Dmxl1	UTSW	18	49878163	missense	probably benign	0.00
R2020:Dmxl1	UTSW	18	49889558	nonsense	probably null
R2116:Dmxl1	UTSW	18	49878817	missense	probably damaging	1.00
R2196:Dmxl1	UTSW	18	49917631	missense	probably benign	0.00
R2206:Dmxl1	UTSW	18	49894094	missense	probably benign	0.12
R2216:Dmxl1	UTSW	18	49893923	missense	probably benign	0.00
R2255:Dmxl1	UTSW	18	49846639	missense	probably benign	0.34
R2333:Dmxl1	UTSW	18	49919976	splice site	probably null
R2343:Dmxl1	UTSW	18	49890678	missense	probably damaging	1.00
R2496:Dmxl1	UTSW	18	49880791	missense	possibly damaging	0.51
R3757:Dmxl1	UTSW	18	49935317	missense	probably damaging	0.98
R3758:Dmxl1	UTSW	18	49935317	missense	probably damaging	0.98
R3783:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3786:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3787:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3885:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3886:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3887:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3888:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3889:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R4014:Dmxl1	UTSW	18	49863962	missense	probably benign
R4033:Dmxl1	UTSW	18	49851431	missense	possibly damaging	0.95
R4096:Dmxl1	UTSW	18	49961197	missense	probably damaging	1.00
R4366:Dmxl1	UTSW	18	49878017	nonsense	probably null
R4406:Dmxl1	UTSW	18	49889553	missense	probably damaging	1.00
R4412:Dmxl1	UTSW	18	49848761	missense	probably benign
R4454:Dmxl1	UTSW	18	49893332	missense	probably benign	0.01
R4459:Dmxl1	UTSW	18	49961216	missense	possibly damaging	0.80
R4569:Dmxl1	UTSW	18	49852360	missense	probably damaging	1.00
R4570:Dmxl1	UTSW	18	49852360	missense	probably damaging	1.00
R4606:Dmxl1	UTSW	18	49962181	missense	probably damaging	0.98
R4649:Dmxl1	UTSW	18	49878631	missense	probably damaging	0.99
R4683:Dmxl1	UTSW	18	49878021	missense	probably damaging	1.00
R4782:Dmxl1	UTSW	18	49862992	missense	probably damaging	1.00
R4878:Dmxl1	UTSW	18	49851476	missense	probably damaging	1.00
R4879:Dmxl1	UTSW	18	49889467	missense	probably damaging	1.00
R4881:Dmxl1	UTSW	18	49957281	intron	probably benign
R4885:Dmxl1	UTSW	18	49878795	missense	probably damaging	0.99
R4916:Dmxl1	UTSW	18	49877697	missense	probably damaging	1.00
R5022:Dmxl1	UTSW	18	49895127	missense	probably damaging	0.99
R5056:Dmxl1	UTSW	18	49870923	missense	probably benign	0.00
R5177:Dmxl1	UTSW	18	49893584	missense	probably damaging	0.99
R5342:Dmxl1	UTSW	18	49951235	missense	probably damaging	0.96
R5421:Dmxl1	UTSW	18	49863119	critical splice donor site	probably null
R5433:Dmxl1	UTSW	18	49867899	splice site	probably null
R5484:Dmxl1	UTSW	18	49889464	missense	probably damaging	1.00
R5598:Dmxl1	UTSW	18	49864478	missense	probably benign	0.04
R5633:Dmxl1	UTSW	18	49877697	missense	probably damaging	1.00
R5638:Dmxl1	UTSW	18	49891626	missense	possibly damaging	0.95
R5694:Dmxl1	UTSW	18	49894257	missense	probably damaging	1.00
R5696:Dmxl1	UTSW	18	49931941	nonsense	probably null
R5706:Dmxl1	UTSW	18	49957395	critical splice donor site	probably null
R5745:Dmxl1	UTSW	18	49846586	missense	probably benign
R5876:Dmxl1	UTSW	18	49870984	missense	possibly damaging	0.70
R6054:Dmxl1	UTSW	18	49857386	missense	probably benign	0.00
R6145:Dmxl1	UTSW	18	49912766	missense	possibly damaging	0.90
R6189:Dmxl1	UTSW	18	49893335	missense	probably benign	0.33
R6213:Dmxl1	UTSW	18	49863015	missense	possibly damaging	0.93
R6219:Dmxl1	UTSW	18	49902367	missense	probably damaging	0.99
R6221:Dmxl1	UTSW	18	49871732	missense	probably damaging	0.96
R6276:Dmxl1	UTSW	18	49846586	missense	probably benign
R6319:Dmxl1	UTSW	18	49852300	missense	probably benign	0.00
R6426:Dmxl1	UTSW	18	49864578	missense	probably damaging	0.99
R6567:Dmxl1	UTSW	18	49859179	missense	probably damaging	0.99
R6739:Dmxl1	UTSW	18	49878246	missense	probably benign	0.03
R6743:Dmxl1	UTSW	18	49880780	missense	possibly damaging	0.95
R6776:Dmxl1	UTSW	18	49893974	missense	probably damaging	1.00
R6827:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6828:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6829:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6830:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6833:Dmxl1	UTSW	18	49955823	missense	probably damaging	0.99
R6834:Dmxl1	UTSW	18	49955823	missense	probably damaging	0.99
R6856:Dmxl1	UTSW	18	49852288	nonsense	probably null
R6881:Dmxl1	UTSW	18	49935305	missense	probably benign	0.00
R6882:Dmxl1	UTSW	18	49843784	critical splice acceptor site	probably null
R6892:Dmxl1	UTSW	18	49920902	missense	probably damaging	0.98
R6897:Dmxl1	UTSW	18	49851495	missense	probably null	0.99
R6897:Dmxl1	UTSW	18	49863057	missense	possibly damaging	0.51
R6917:Dmxl1	UTSW	18	49864148	missense	probably damaging	1.00
R7192:Dmxl1	UTSW	18	49955853	missense	probably damaging	0.99
R7447:Dmxl1	UTSW	18	49864614	missense	probably damaging	0.99
R7460:Dmxl1	UTSW	18	49878612	missense	probably benign	0.00
R7570:Dmxl1	UTSW	18	49893957	missense	possibly damaging	0.82
R7626:Dmxl1	UTSW	18	49902794	missense	probably benign
R7629:Dmxl1	UTSW	18	49859270	missense	probably damaging	1.00
R7644:Dmxl1	UTSW	18	49893552	missense	probably benign
R7688:Dmxl1	UTSW	18	49955871	missense	probably benign	0.03
R7689:Dmxl1	UTSW	18	49846618	missense	probably benign	0.00
R7712:Dmxl1	UTSW	18	49893461	missense	probably damaging	0.99
R7808:Dmxl1	UTSW	18	49878315	missense	probably benign	0.00
R7834:Dmxl1	UTSW	18	49920977	missense	probably damaging	1.00
R7848:Dmxl1	UTSW	18	49840490	missense	possibly damaging	0.88
R7849:Dmxl1	UTSW	18	49961147	missense	probably benign	0.00
R7881:Dmxl1	UTSW	18	49864383	missense	probably damaging	0.99
R7884:Dmxl1	UTSW	18	49893407	missense	possibly damaging	0.65
R8073:Dmxl1	UTSW	18	49878433	missense	probably damaging	1.00
R8089:Dmxl1	UTSW	18	49888830	missense	probably damaging	0.99
R8266:Dmxl1	UTSW	18	49843811	missense	probably benign	0.17
R8371:Dmxl1	UTSW	18	49898714	missense	probably benign	0.08
RF009:Dmxl1	UTSW	18	49893394	missense	probably damaging	0.96
X0025:Dmxl1	UTSW	18	49864368	missense	probably damaging	0.98
X0066:Dmxl1	UTSW	18	49919899	missense	probably damaging	1.00
Z1088:Dmxl1	UTSW	18	49920965	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCTTGCCACTCGGTATTAC -3'
(R):5'- TGCACTAGGAGAGTTGCAGTATG -3'

Sequencing Primer
(F):5'- TACCTTTATTACTGACAACGTCACAC -3'
(R):5'- AAATGGAAATCAGTGTGCTTACC -3'

Posted On

2018-09-12