Incidental Mutation 'R6857:Pygm'
ID535344
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Namemuscle glycogen phosphorylase
SynonymsPG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6857 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6384399-6398459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6393757 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 583 (G583C)
Ref Sequence ENSEMBL: ENSMUSP00000109111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000113483]
Predicted Effect probably damaging
Transcript: ENSMUST00000035269
AA Change: G671C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648
AA Change: G671C

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113483
AA Change: G583C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648
AA Change: G583C

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Meta Mutation Damage Score 0.9700 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,432,102 H107Q probably benign Het
Abca6 A G 11: 110,219,688 L545P possibly damaging Het
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Ahnak C T 19: 9,037,168 Q119* probably null Het
AI314180 T A 4: 58,814,065 D1347V probably damaging Het
Anxa10 C A 8: 62,061,017 A239S probably benign Het
B020011L13Rik A T 1: 117,801,288 H175L probably benign Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Best2 A G 8: 85,007,823 V422A probably benign Het
Cc2d2b T C 19: 40,770,865 F298S possibly damaging Het
Cd38 T A 5: 43,906,198 M211K probably damaging Het
Cd3d T G 9: 44,985,604 M92R probably damaging Het
Cdk5rap2 C A 4: 70,245,396 E1474* probably null Het
Clvs1 A G 4: 9,449,433 K341E probably benign Het
Copg2 G T 6: 30,863,598 D112E possibly damaging Het
Dmxl1 A T 18: 49,864,835 N697Y probably damaging Het
Dync1h1 T C 12: 110,658,547 S3803P possibly damaging Het
Epx T A 11: 87,869,955 K384* probably null Het
Fam135a G C 1: 24,014,789 D1222E probably damaging Het
Fndc1 T A 17: 7,772,170 H898L unknown Het
Gapvd1 A G 2: 34,728,377 I190T probably damaging Het
Gm14139 G T 2: 150,192,062 C132F probably damaging Het
Hax1 T G 3: 89,997,452 S122R probably damaging Het
Hdac9 T G 12: 34,393,363 M272L probably benign Het
Itgb7 T C 15: 102,223,465 S228G probably damaging Het
Itpr2 C A 6: 146,397,019 E315* probably null Het
Kctd8 T C 5: 69,296,702 N331D probably benign Het
Ky G A 9: 102,542,432 G546E probably damaging Het
Lao1 T C 4: 118,963,826 probably null Het
Mtmr12 T A 15: 12,263,832 W427R probably damaging Het
Mxra8 A G 4: 155,843,136 K434E possibly damaging Het
Myh4 T C 11: 67,249,885 C676R possibly damaging Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Olfr1082 A T 2: 86,594,264 L188H probably damaging Het
Olfr1141 A T 2: 87,753,487 C169S probably damaging Het
Olfr914 T C 9: 38,607,011 L182P probably benign Het
Paqr5 G T 9: 61,976,088 H41N probably damaging Het
Plekha8 T C 6: 54,629,935 L405P probably damaging Het
Plpbp A G 8: 27,045,426 N79S possibly damaging Het
Plxnd1 G T 6: 115,993,763 A348E probably benign Het
Prdm9 T C 17: 15,544,256 Q754R probably benign Het
Rgs12 A T 5: 35,030,022 K213* probably null Het
Serpina3m T C 12: 104,389,326 L84P probably damaging Het
Tab2 T C 10: 7,920,413 T102A possibly damaging Het
Tagln3 G T 16: 45,724,236 A24E probably benign Het
Tanc2 A G 11: 105,910,288 E1110G possibly damaging Het
Tcf3 T C 10: 80,416,899 probably null Het
Tmem14a T C 1: 21,229,545 probably benign Het
Ttn T A 2: 76,917,931 E4258V possibly damaging Het
Ubr4 G A 4: 139,486,051 D5104N possibly damaging Het
Ugt2b37 C G 5: 87,240,846 A503P probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r88 A T 7: 13,178,331 M205L possibly damaging Het
Vmn2r109 C T 17: 20,540,670 M808I probably benign Het
Wdr72 G T 9: 74,155,041 V490L probably damaging Het
Zgrf1 T A 3: 127,581,447 V785E probably damaging Het
Zswim7 A T 11: 62,281,129 probably benign Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6391394 missense probably benign
IGL01743:Pygm APN 19 6392994 splice site probably null
IGL01827:Pygm APN 19 6390377 missense probably damaging 1.00
IGL02032:Pygm APN 19 6388087 missense probably benign 0.23
IGL02261:Pygm APN 19 6388271 missense probably damaging 1.00
IGL02431:Pygm APN 19 6388118 missense probably damaging 1.00
IGL02511:Pygm APN 19 6385688 missense probably benign 0.22
IGL02967:Pygm APN 19 6393838 missense probably damaging 1.00
IGL03081:Pygm APN 19 6388821 missense possibly damaging 0.53
R0336:Pygm UTSW 19 6388758 missense probably damaging 1.00
R0415:Pygm UTSW 19 6391366 missense probably benign 0.06
R0799:Pygm UTSW 19 6386018 intron probably benign
R1445:Pygm UTSW 19 6389887 missense probably benign 0.20
R1752:Pygm UTSW 19 6391034 missense probably damaging 0.99
R1828:Pygm UTSW 19 6397607 missense possibly damaging 0.72
R2054:Pygm UTSW 19 6388155 missense probably benign 0.02
R2086:Pygm UTSW 19 6391481 critical splice donor site probably null
R2116:Pygm UTSW 19 6386408 missense probably damaging 0.98
R2431:Pygm UTSW 19 6393785 missense probably damaging 1.00
R2516:Pygm UTSW 19 6397601 missense probably benign 0.20
R3938:Pygm UTSW 19 6392950 missense probably benign 0.42
R4609:Pygm UTSW 19 6391409 missense possibly damaging 0.92
R4924:Pygm UTSW 19 6393724 missense probably damaging 1.00
R4995:Pygm UTSW 19 6398139 missense probably damaging 1.00
R5225:Pygm UTSW 19 6389464 missense probably benign 0.01
R5296:Pygm UTSW 19 6384579 missense probably damaging 1.00
R5437:Pygm UTSW 19 6390382 missense probably damaging 1.00
R5994:Pygm UTSW 19 6398043 critical splice acceptor site probably null
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6188:Pygm UTSW 19 6397937 splice site probably null
R6266:Pygm UTSW 19 6398139 missense probably damaging 1.00
R6799:Pygm UTSW 19 6398127 missense probably damaging 1.00
R6855:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6856:Pygm UTSW 19 6393757 missense probably damaging 1.00
R7223:Pygm UTSW 19 6388863 missense probably benign
R7256:Pygm UTSW 19 6385896 missense probably benign 0.01
R7263:Pygm UTSW 19 6388327 missense probably damaging 1.00
R7398:Pygm UTSW 19 6385936 missense probably damaging 1.00
R8093:Pygm UTSW 19 6386042 missense probably damaging 1.00
R8351:Pygm UTSW 19 6388087 missense possibly damaging 0.83
R8499:Pygm UTSW 19 6390362 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCAGGTTGGGATCTATGAAAGGC -3'
(R):5'- TAAGATGTGACACAGGCCGG -3'

Sequencing Primer
(F):5'- TCTATGAAAGGCTGGGTTGAAG -3'
(R):5'- CAGCATGCCTCTTGACTGTGAG -3'
Posted On2018-09-12