Incidental Mutation 'R6858:Lmx1a'
ID535348
Institutional Source Beutler Lab
Gene Symbol Lmx1a
Ensembl Gene ENSMUSG00000026686
Gene NameLIM homeobox transcription factor 1 alpha
Synonymsshaker short-tail, Lmx1.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location167689237-167848741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167832881 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 245 (N245I)
Ref Sequence ENSEMBL: ENSMUSP00000107008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028003] [ENSMUST00000111377]
Predicted Effect probably damaging
Transcript: ENSMUST00000028003
AA Change: N245I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028003
Gene: ENSMUSG00000026686
AA Change: N245I

DomainStartEndE-ValueType
LIM 34 85 2.87e-15 SMART
LIM 93 147 3.39e-17 SMART
HOX 195 257 2.62e-21 SMART
low complexity region 337 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111377
AA Change: N245I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107008
Gene: ENSMUSG00000026686
AA Change: N245I

DomainStartEndE-ValueType
LIM 34 85 2.87e-15 SMART
LIM 93 147 3.39e-17 SMART
HOX 195 257 2.62e-21 SMART
low complexity region 337 350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeodomain and LIM-domain containing protein. The encoded protein is a transcription factor that acts as a positive regulator of insulin gene transcription. This gene also plays a role in the development of dopamine producing neurons during embryogenesis. Mutations in this gene are associated with an increased risk of developing Parkinson's disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mutations in the dreher locus produce neurological and skeletal abnormalities, inner ear defects, and belly spotting. Deafness and hypoplasia of Mullerian duct derivatives are also reported for some alleles. Homozygous null mice have fewer dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Lmx1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02624:Lmx1a APN 1 167844623 splice site probably benign
IGL02629:Lmx1a APN 1 167844623 splice site probably benign
IGL02637:Lmx1a APN 1 167844623 splice site probably benign
IGL02642:Lmx1a APN 1 167844623 splice site probably benign
IGL02811:Lmx1a APN 1 167791374 missense probably benign 0.06
scooby UTSW 1 167830687 missense possibly damaging 0.47
R0320:Lmx1a UTSW 1 167791404 nonsense probably null
R1217:Lmx1a UTSW 1 167791399 missense probably damaging 1.00
R2897:Lmx1a UTSW 1 167830540 splice site probably benign
R4211:Lmx1a UTSW 1 167832859 missense probably damaging 0.96
R4976:Lmx1a UTSW 1 167791554 missense possibly damaging 0.73
R5125:Lmx1a UTSW 1 167830687 missense possibly damaging 0.47
R7099:Lmx1a UTSW 1 167830546 missense probably damaging 1.00
R7177:Lmx1a UTSW 1 167846678 missense probably benign
R7380:Lmx1a UTSW 1 167692040 missense probably damaging 1.00
R7831:Lmx1a UTSW 1 167840952 missense probably benign 0.06
R7914:Lmx1a UTSW 1 167840952 missense probably benign 0.06
Z1176:Lmx1a UTSW 1 167691999 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTAGGAATGTGACCTATGCCCC -3'
(R):5'- TAACACAGACACTTCGCTTCTC -3'

Sequencing Primer
(F):5'- GGCACCACCCAGGAAATG -3'
(R):5'- TTCCTCCAGGCGCTGTG -3'
Posted On2018-09-12