Mutagenetix > Incidental Mutation

Incidental Mutation 'R6858:Itga8'

535349

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R6858 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12200081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 515 (V515A)

Ref Sequence

ENSEMBL: ENSMUSP00000134154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably benign
Transcript: ENSMUST00000028106
AA Change: V515A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V515A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791
AA Change: V515A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: V515A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	T	C	2: 23,212,664	V138A	possibly damaging	Het
Aldob	T	C	4: 49,538,796	T241A	probably benign	Het
Arid4a	A	G	12: 71,023,509	I65V	probably benign	Het
Bhmt2	C	T	13: 93,671,440	E47K	probably damaging	Het
Bpifa3	G	A	2: 154,137,594	G213D	probably benign	Het
C4b	C	G	17: 34,729,831	A1548P	probably damaging	Het
Ccdc39	A	G	3: 33,819,868	V605A	probably damaging	Het
Cept1	A	T	3: 106,512,879		probably null	Het
Cntrl	T	C	2: 35,162,095		probably null	Het
Col3a1	A	G	1: 45,345,984	D87G	probably damaging	Het
Crim1	A	T	17: 78,315,627	E418V	probably damaging	Het
Crtac1	T	C	19: 42,318,735	I196M	possibly damaging	Het
Crtap	T	C	9: 114,380,016	Y320C	probably damaging	Het
Cttnbp2	A	G	6: 18,448,453	V27A	probably damaging	Het
Cyp2c69	G	A	19: 39,877,565	L195F	probably benign	Het
Cyp2d26	G	A	15: 82,794,083	R31C	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fign	G	T	2: 63,979,813	T371K	probably benign	Het
Fryl	T	C	5: 73,065,032	T2069A	probably damaging	Het
Gm3486	A	G	14: 41,488,365	I53T	probably damaging	Het
Gprc5d	T	C	6: 135,116,315	N198S	possibly damaging	Het
Ighv1-42	A	G	12: 114,937,346	S40P	probably damaging	Het
Kidins220	A	T	12: 25,008,543	I523L	possibly damaging	Het
Lmx1a	A	T	1: 167,832,881	N245I	probably damaging	Het
Med22	T	C	2: 26,905,937	D157G	possibly damaging	Het
Ola1	T	C	2: 73,097,230	H335R	probably damaging	Het
Olfr1099	A	G	2: 86,958,690	I256T	probably benign	Het
Olfr1259	A	G	2: 89,943,743	I124T	probably damaging	Het
Olfr403	A	T	11: 74,196,099	M199L	probably benign	Het
Olfr806	A	G	10: 129,738,464	F151S	probably damaging	Het
Olfr857	T	C	9: 19,713,469	I214T	probably damaging	Het
Pde1a	T	A	2: 80,129,158		probably benign	Het
Pdgfrb	G	A	18: 61,065,147	G304D	probably benign	Het
Prune2	T	A	19: 17,118,106	C325S	possibly damaging	Het
Ptk2b	T	C	14: 66,213,398	I40V	probably damaging	Het
Qrich1	A	G	9: 108,534,134	D286G	probably damaging	Het
Scn5a	T	C	9: 119,492,090	I1469V	probably benign	Het
Serpina3k	G	A	12: 104,345,245	A361T	possibly damaging	Het
Slc25a23	A	G	17: 57,058,171	Y73H	probably damaging	Het
Tmco3	A	G	8: 13,313,924	D82G	probably damaging	Het
Trbv29	G	T	6: 41,271,690	M51I	probably damaging	Het
Unc13b	A	T	4: 43,165,828	H204L	possibly damaging	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Vmn1r25	T	C	6: 57,979,011	S98G	probably benign	Het
Vmn2r2	A	G	3: 64,137,494	F77S	probably damaging	Het
Vmn2r79	A	T	7: 87,037,372	M654L	probably benign	Het
Zfp985	A	T	4: 147,583,307	K211*	probably null	Het
Zwilch	C	T	9: 64,153,587	D328N	probably damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCTCCTCTGGTAACACAGAC -3'
(R):5'- ATGTTGCGTTGACAATGGC -3'

Sequencing Primer
(F):5'- TGGTAACACAGACTCTTTGCCAC -3'
(R):5'- CGTTGACAATGGCTTCTTGAG -3'

Posted On

2018-09-12