Incidental Mutation 'R6858:Fign'
ID535353
Institutional Source Beutler Lab
Gene Symbol Fign
Ensembl Gene ENSMUSG00000075324
Gene Namefidgetin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location63971507-64098038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63979813 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 371 (T371K)
Ref Sequence ENSEMBL: ENSMUSP00000122855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102728] [ENSMUST00000131615]
Predicted Effect probably benign
Transcript: ENSMUST00000102728
Predicted Effect probably benign
Transcript: ENSMUST00000131615
AA Change: T371K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122855
Gene: ENSMUSG00000075324
AA Change: T371K

DomainStartEndE-ValueType
low complexity region 204 235 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 259 291 N/A INTRINSIC
AAA 518 654 7.03e-12 SMART
Pfam:Vps4_C 708 756 2.1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype PHENOTYPE: Homozygotes for a reporter allele show pre- and postnatal death, head-shaking, and small eyes. Spontaneous mutants show head-shaking, circling, reduced or absent semicircular canals, small abnormal eyes, aberrant cell-cycling, female sterility, and low prenetrance craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Fign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Fign APN 2 63979010 missense probably damaging 0.99
IGL01149:Fign APN 2 63979760 missense possibly damaging 0.92
IGL01328:Fign APN 2 63978872 missense probably damaging 0.97
IGL01448:Fign APN 2 63979688 missense probably damaging 0.97
IGL01680:Fign APN 2 63978644 utr 3 prime probably benign
IGL01989:Fign APN 2 63980450 missense probably benign
IGL02010:Fign APN 2 63980400 missense probably damaging 0.98
IGL02092:Fign APN 2 63980583 missense possibly damaging 0.95
IGL02252:Fign APN 2 63980639 missense probably benign 0.14
IGL02455:Fign APN 2 63980497 missense probably benign 0.22
IGL02541:Fign APN 2 63979537 missense probably benign 0.38
IGL03109:Fign APN 2 63980662 missense possibly damaging 0.83
R0534:Fign UTSW 2 63980791 missense probably damaging 0.96
R0630:Fign UTSW 2 63980141 missense possibly damaging 0.86
R1678:Fign UTSW 2 63980374 missense probably damaging 0.99
R2512:Fign UTSW 2 63979799 missense probably benign 0.03
R3125:Fign UTSW 2 63978700 missense possibly damaging 0.94
R4679:Fign UTSW 2 63979261 missense probably damaging 1.00
R4735:Fign UTSW 2 63980438 missense probably damaging 1.00
R4753:Fign UTSW 2 63979019 missense probably benign 0.04
R5071:Fign UTSW 2 63979693 nonsense probably null
R5072:Fign UTSW 2 63979693 nonsense probably null
R5073:Fign UTSW 2 63979693 nonsense probably null
R5074:Fign UTSW 2 63979693 nonsense probably null
R5344:Fign UTSW 2 63979225 missense probably benign 0.01
R5427:Fign UTSW 2 63978998 missense probably damaging 1.00
R5922:Fign UTSW 2 63979060 missense probably damaging 0.99
R6115:Fign UTSW 2 63979310 missense probably benign 0.22
R6373:Fign UTSW 2 63979645 missense probably benign 0.06
R6542:Fign UTSW 2 63980295 missense possibly damaging 0.53
R6637:Fign UTSW 2 64027908 intron probably benign
R7188:Fign UTSW 2 63979606 missense possibly damaging 0.95
R7309:Fign UTSW 2 63979957 missense possibly damaging 0.77
R7429:Fign UTSW 2 63979060 missense probably damaging 0.99
R7430:Fign UTSW 2 63979060 missense probably damaging 0.99
R7608:Fign UTSW 2 63978719 missense possibly damaging 0.75
R7642:Fign UTSW 2 63980572 missense probably benign 0.16
R7782:Fign UTSW 2 63979162 missense probably damaging 1.00
X0028:Fign UTSW 2 63980851 missense probably damaging 1.00
Z1088:Fign UTSW 2 64096902 missense probably benign 0.01
Z1177:Fign UTSW 2 63979385 missense probably damaging 1.00
Z1177:Fign UTSW 2 63979690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCGTGCTCACTCATGACTG -3'
(R):5'- ATGGTTTGACACCCATTGCAC -3'

Sequencing Primer
(F):5'- TCATGACTGGCGACGTATAC -3'
(R):5'- TCTGCTCTGACCAACAATTCAG -3'
Posted On2018-09-12