Incidental Mutation 'R6858:Olfr1259'
ID535357
Institutional Source Beutler Lab
Gene Symbol Olfr1259
Ensembl Gene ENSMUSG00000068806
Gene Nameolfactory receptor 1259
SynonymsGA_x6K02T2Q125-51376062-51375133, MOR232-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89940532-89948664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89943743 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 124 (I124T)
Ref Sequence ENSEMBL: ENSMUSP00000149652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090695] [ENSMUST00000214846]
Predicted Effect probably damaging
Transcript: ENSMUST00000090695
AA Change: I124T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088194
Gene: ENSMUSG00000068806
AA Change: I124T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 8.9e-45 PFAM
Pfam:7tm_1 39 285 5.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214846
AA Change: I124T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Olfr1259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1259 APN 2 89943260 missense probably damaging 0.96
IGL01446:Olfr1259 APN 2 89943938 missense probably damaging 0.99
IGL01830:Olfr1259 APN 2 89943431 missense probably benign 0.03
IGL02160:Olfr1259 APN 2 89943805 missense probably damaging 1.00
PIT4280001:Olfr1259 UTSW 2 89943743 missense probably damaging 1.00
R0366:Olfr1259 UTSW 2 89943818 missense possibly damaging 0.89
R0550:Olfr1259 UTSW 2 89943389 missense probably damaging 0.99
R0587:Olfr1259 UTSW 2 89943392 missense probably damaging 1.00
R1383:Olfr1259 UTSW 2 89943551 missense probably benign 0.12
R1400:Olfr1259 UTSW 2 89943542 missense possibly damaging 0.82
R1851:Olfr1259 UTSW 2 89943814 nonsense probably null
R1953:Olfr1259 UTSW 2 89943923 missense probably damaging 1.00
R2330:Olfr1259 UTSW 2 89943953 missense probably benign
R3897:Olfr1259 UTSW 2 89943809 missense probably benign 0.24
R3955:Olfr1259 UTSW 2 89943828 missense possibly damaging 0.90
R4687:Olfr1259 UTSW 2 89943869 missense probably damaging 0.98
R4976:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5119:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5291:Olfr1259 UTSW 2 89943436 nonsense probably null
R5415:Olfr1259 UTSW 2 89943387 missense probably benign 0.25
R5546:Olfr1259 UTSW 2 89943585 missense probably damaging 1.00
R5588:Olfr1259 UTSW 2 89943792 missense probably benign 0.00
R6633:Olfr1259 UTSW 2 89943366 missense probably benign
R7294:Olfr1259 UTSW 2 89943724 nonsense probably null
R8261:Olfr1259 UTSW 2 89943372 missense probably benign 0.00
R8319:Olfr1259 UTSW 2 89943680 missense possibly damaging 0.87
Z1088:Olfr1259 UTSW 2 89943770 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTGGCAGCCACAAAGAGAC -3'
(R):5'- TGAGCCACCTCTCCTTGATAG -3'

Sequencing Primer
(F):5'- GTGTGTCCATGCAAACAAGTTCC -3'
(R):5'- GCATGGCTCAAGTCTATG -3'
Posted On2018-09-12