Incidental Mutation 'R6858:Cept1'
ID535361
Institutional Source Beutler Lab
Gene Symbol Cept1
Ensembl Gene ENSMUSG00000040774
Gene Namecholine/ethanolaminephosphotransferase 1
Synonyms9930118K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location106502260-106547802 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 106512879 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039153] [ENSMUST00000068301] [ENSMUST00000121231] [ENSMUST00000192438]
Predicted Effect probably benign
Transcript: ENSMUST00000039153
SMART Domains Protein: ENSMUSP00000037277
Gene: ENSMUSG00000040774

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 229 6.4e-23 PFAM
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 281 303 N/A INTRINSIC
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068301
AA Change: V213E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065743
Gene: ENSMUSG00000040774
AA Change: V213E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 328 3.2e-21 PFAM
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121231
AA Change: V213E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112509
Gene: ENSMUSG00000040774
AA Change: V213E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 83 158 7.4e-18 PFAM
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 285 304 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192438
SMART Domains Protein: ENSMUSP00000142097
Gene: ENSMUSG00000040774

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 215 2.3e-20 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene codes for a choline/ethanolaminephosphotransferase, which functions in the synthesis of choline- or ethanolamine- containing phospholipids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Conditional homozygous knockout in skeletal muscle leads to improved glucose tolerance, increased insulin sensitivity and muscle weakness in mice fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Cept1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cept1 APN 3 106505803 missense possibly damaging 0.95
IGL01860:Cept1 APN 3 106531128 intron probably benign
IGL02053:Cept1 APN 3 106533396 missense probably damaging 1.00
IGL02351:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02358:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02568:Cept1 APN 3 106503719 missense probably benign 0.03
IGL02960:Cept1 APN 3 106539396 nonsense probably null
IGL03019:Cept1 APN 3 106504641 missense probably damaging 1.00
IGL03182:Cept1 APN 3 106504550 missense probably damaging 1.00
IGL03401:Cept1 APN 3 106533390 missense probably damaging 1.00
R2128:Cept1 UTSW 3 106512879 missense probably damaging 1.00
R2928:Cept1 UTSW 3 106531152 missense probably benign 0.07
R3688:Cept1 UTSW 3 106520015 missense probably benign 0.00
R4762:Cept1 UTSW 3 106539361 nonsense probably null
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4890:Cept1 UTSW 3 106505807 missense probably damaging 1.00
R5506:Cept1 UTSW 3 106531248 missense probably benign 0.00
R5999:Cept1 UTSW 3 106533443 missense probably damaging 1.00
R6106:Cept1 UTSW 3 106503676 missense probably benign 0.00
R6478:Cept1 UTSW 3 106533445 nonsense probably null
R6560:Cept1 UTSW 3 106505278 missense possibly damaging 0.84
R7372:Cept1 UTSW 3 106503740 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTCAATGGCCTTCAAAGCAC -3'
(R):5'- ACTTCAGACTGTGTAGCTATGC -3'

Sequencing Primer
(F):5'- TGGCCTTCAAAGCACACTTAG -3'
(R):5'- GTAGCTATGCAATGTAATTCTCTGC -3'
Posted On2018-09-12