Incidental Mutation 'R6858:Vmn1r25'
ID535368
Institutional Source Beutler Lab
Gene Symbol Vmn1r25
Ensembl Gene ENSMUSG00000115668
Gene Namevomeronasal 1 receptor 25
SynonymsV1rc8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location57978299-57980810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57979011 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 98 (S98G)
Ref Sequence ENSEMBL: ENSMUSP00000154074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176572] [ENSMUST00000228585]
Predicted Effect probably benign
Transcript: ENSMUST00000176572
AA Change: S98G

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135860
Gene: ENSMUSG00000115668
AA Change: S98G

DomainStartEndE-ValueType
Pfam:V1R 29 293 5.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228585
AA Change: S98G

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Vmn1r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Vmn1r25 APN 6 57979211 missense probably damaging 0.99
R0299:Vmn1r25 UTSW 6 57978509 missense probably damaging 1.00
R0401:Vmn1r25 UTSW 6 57978711 missense probably benign 0.01
R0499:Vmn1r25 UTSW 6 57978509 missense probably damaging 1.00
R1294:Vmn1r25 UTSW 6 57978479 missense possibly damaging 0.55
R1562:Vmn1r25 UTSW 6 57978801 missense probably benign 0.03
R1661:Vmn1r25 UTSW 6 57978461 missense probably damaging 1.00
R1665:Vmn1r25 UTSW 6 57978461 missense probably damaging 1.00
R1879:Vmn1r25 UTSW 6 57978927 missense possibly damaging 0.50
R2221:Vmn1r25 UTSW 6 57979238 missense probably damaging 1.00
R2223:Vmn1r25 UTSW 6 57979238 missense probably damaging 1.00
R2374:Vmn1r25 UTSW 6 57978558 missense probably benign 0.10
R4073:Vmn1r25 UTSW 6 57978587 missense possibly damaging 0.94
R4398:Vmn1r25 UTSW 6 57978827 missense probably damaging 1.00
R4590:Vmn1r25 UTSW 6 57978495 missense probably benign 0.02
R4779:Vmn1r25 UTSW 6 57979026 missense probably damaging 0.98
R5397:Vmn1r25 UTSW 6 57979075 nonsense probably null
R6113:Vmn1r25 UTSW 6 57978572 missense probably benign 0.00
R7407:Vmn1r25 UTSW 6 57979059 missense possibly damaging 0.76
R7748:Vmn1r25 UTSW 6 57978564 missense probably damaging 1.00
R8001:Vmn1r25 UTSW 6 57979080 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAACAGGATTCAGTGACTCTCATC -3'
(R):5'- ATGTCATAGATCAAAGCCCATGG -3'

Sequencing Primer
(F):5'- ATTCAGTGACTCTCATCTGGTTG -3'
(R):5'- GTCATAGATCAAAGCCCATGGATCTG -3'
Posted On2018-09-12