Incidental Mutation 'R6858:Vamp5'
ID535369
Institutional Source Beutler Lab
Gene Symbol Vamp5
Ensembl Gene ENSMUSG00000073002
Gene Namevesicle-associated membrane protein 5
SynonymsCamp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R6858 (G1)
Quality Score108.008
Status Validated
Chromosome6
Chromosomal Location72368794-72380468 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 72380441 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059983] [ENSMUST00000074231] [ENSMUST00000101285] [ENSMUST00000142613]
Predicted Effect probably benign
Transcript: ENSMUST00000059983
SMART Domains Protein: ENSMUSP00000059501
Gene: ENSMUSG00000050732

DomainStartEndE-ValueType
Pfam:Synaptobrevin 9 97 1.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074231
SMART Domains Protein: ENSMUSP00000073852
Gene: ENSMUSG00000073002

DomainStartEndE-ValueType
Pfam:Synaptobrevin 2 90 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101285
SMART Domains Protein: ENSMUSP00000098843
Gene: ENSMUSG00000073002

DomainStartEndE-ValueType
Pfam:Synaptobrevin 2 90 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142613
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of vesicles and cell membranes. The VAMP5 gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family and the SNARE superfamily. This VAMP family member may participate in vesicle trafficking events that are associated with myogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Vamp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0782:Vamp5 UTSW 6 72369470 missense probably damaging 0.97
R2937:Vamp5 UTSW 6 72369340 missense probably benign 0.20
R2938:Vamp5 UTSW 6 72369340 missense probably benign 0.20
R4894:Vamp5 UTSW 6 72370198 missense possibly damaging 0.93
R6813:Vamp5 UTSW 6 72380441 unclassified probably benign
R6814:Vamp5 UTSW 6 72380441 unclassified probably benign
R6825:Vamp5 UTSW 6 72380441 unclassified probably benign
R6853:Vamp5 UTSW 6 72380441 unclassified probably benign
R8073:Vamp5 UTSW 6 72380453 unclassified probably benign
R8354:Vamp5 UTSW 6 72370393 start gained probably benign
R8454:Vamp5 UTSW 6 72370393 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCAAAGTTGGGGACTAGTC -3'
(R):5'- TTTTGCATGACGGAATGACG -3'

Sequencing Primer
(F):5'- ACTAGTCCGTGCGACCAG -3'
(R):5'- TGGGCTAACTCCTGATGCAG -3'
Posted On2018-09-12