Incidental Mutation 'R6858:Kidins220'
ID535381
Institutional Source Beutler Lab
Gene Symbol Kidins220
Ensembl Gene ENSMUSG00000036333
Gene Namekinase D-interacting substrate 220
SynonymsC330002I19Rik, 3110039L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location24974925-25063152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25008543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 523 (I523L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]
Predicted Effect probably benign
Transcript: ENSMUST00000066652
AA Change: I694L

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: I694L

DomainStartEndE-ValueType
ANK 37 66 1.11e-7 SMART
ANK 70 99 2.25e-3 SMART
ANK 103 132 4.78e-7 SMART
ANK 136 165 5.53e-3 SMART
ANK 169 198 2.52e-6 SMART
ANK 202 231 6.26e-2 SMART
ANK 235 264 1.22e-4 SMART
ANK 268 297 6.92e-4 SMART
ANK 301 330 1.57e-2 SMART
ANK 334 363 9.78e-4 SMART
ANK 367 398 4.6e0 SMART
Pfam:KAP_NTPase 440 953 1.2e-112 PFAM
low complexity region 1077 1092 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1382 1396 N/A INTRINSIC
low complexity region 1422 1452 N/A INTRINSIC
low complexity region 1509 1520 N/A INTRINSIC
low complexity region 1544 1555 N/A INTRINSIC
low complexity region 1561 1567 N/A INTRINSIC
low complexity region 1596 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220459
AA Change: I652L

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222013
AA Change: I523L

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222941
AA Change: I694L

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Kidins220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Kidins220 APN 12 25038560 splice site probably benign
IGL00959:Kidins220 APN 12 25051133 missense possibly damaging 0.74
IGL00978:Kidins220 APN 12 25057474 missense probably damaging 1.00
IGL01144:Kidins220 APN 12 25010926 missense probably damaging 1.00
IGL01326:Kidins220 APN 12 25038499 missense probably damaging 0.97
IGL01545:Kidins220 APN 12 25040460 missense possibly damaging 0.66
IGL01802:Kidins220 APN 12 24995000 missense probably damaging 1.00
IGL01875:Kidins220 APN 12 25057729 missense probably benign 0.00
IGL02160:Kidins220 APN 12 25004111 missense probably damaging 1.00
IGL02383:Kidins220 APN 12 24997333 splice site probably benign
IGL02673:Kidins220 APN 12 24994992 missense probably damaging 1.00
IGL02800:Kidins220 APN 12 25003093 missense probably damaging 1.00
IGL03345:Kidins220 APN 12 25003045 missense probably damaging 1.00
IGL03379:Kidins220 APN 12 25008448 missense probably damaging 0.99
IGL03412:Kidins220 APN 12 24999345 missense probably damaging 1.00
P0043:Kidins220 UTSW 12 25008156 missense probably damaging 1.00
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0269:Kidins220 UTSW 12 25040512 missense probably damaging 0.98
R0280:Kidins220 UTSW 12 25010141 missense probably damaging 1.00
R0334:Kidins220 UTSW 12 25008069 missense probably damaging 1.00
R1601:Kidins220 UTSW 12 25005088 missense probably benign 0.35
R1778:Kidins220 UTSW 12 25013446 splice site probably benign
R1808:Kidins220 UTSW 12 25003009 missense probably benign 0.00
R1855:Kidins220 UTSW 12 25056591 missense probably damaging 1.00
R1965:Kidins220 UTSW 12 24994906 missense probably damaging 1.00
R1982:Kidins220 UTSW 12 25051194 missense probably benign 0.01
R2069:Kidins220 UTSW 12 24987006 splice site probably benign
R2101:Kidins220 UTSW 12 25057423 missense probably damaging 1.00
R2124:Kidins220 UTSW 12 25041303 critical splice donor site probably null
R2371:Kidins220 UTSW 12 25057324 missense probably damaging 1.00
R2405:Kidins220 UTSW 12 25011509 missense probably damaging 0.99
R3522:Kidins220 UTSW 12 24990758 missense probably damaging 1.00
R3877:Kidins220 UTSW 12 25001565 splice site probably benign
R3915:Kidins220 UTSW 12 25053958 missense possibly damaging 0.93
R4023:Kidins220 UTSW 12 25057144 intron probably null
R4287:Kidins220 UTSW 12 25056846 missense possibly damaging 0.81
R4476:Kidins220 UTSW 12 25011001 missense probably damaging 1.00
R4495:Kidins220 UTSW 12 25038302 intron probably null
R4627:Kidins220 UTSW 12 25057042 missense possibly damaging 0.89
R4807:Kidins220 UTSW 12 25057285 missense probably damaging 1.00
R4899:Kidins220 UTSW 12 25013443 critical splice donor site probably null
R4960:Kidins220 UTSW 12 24992260 nonsense probably null
R5118:Kidins220 UTSW 12 24992297 missense probably damaging 1.00
R5183:Kidins220 UTSW 12 25051126 missense probably benign 0.17
R5238:Kidins220 UTSW 12 25003010 missense probably benign 0.31
R5580:Kidins220 UTSW 12 25047897 missense probably benign 0.00
R5707:Kidins220 UTSW 12 25013391 missense probably damaging 1.00
R5813:Kidins220 UTSW 12 25057140 nonsense probably null
R6131:Kidins220 UTSW 12 24992314 splice site probably null
R6146:Kidins220 UTSW 12 25052813 missense probably damaging 1.00
R6151:Kidins220 UTSW 12 25056909 missense possibly damaging 0.65
R6160:Kidins220 UTSW 12 24997311 missense probably damaging 1.00
R6187:Kidins220 UTSW 12 25051308 intron probably null
R6289:Kidins220 UTSW 12 25056616 missense probably damaging 1.00
R6321:Kidins220 UTSW 12 25057534 missense probably benign 0.09
R6450:Kidins220 UTSW 12 25057191 missense probably benign
R6513:Kidins220 UTSW 12 25038435 missense possibly damaging 0.94
R6652:Kidins220 UTSW 12 25010060 splice site probably null
R6711:Kidins220 UTSW 12 24998751 missense probably damaging 0.96
R7102:Kidins220 UTSW 12 25057663 missense probably benign 0.00
R7112:Kidins220 UTSW 12 25004019 missense probably damaging 1.00
R7139:Kidins220 UTSW 12 24994821 missense probably damaging 1.00
R7140:Kidins220 UTSW 12 25036624 missense probably damaging 1.00
R7271:Kidins220 UTSW 12 25011571 missense probably benign 0.21
R7361:Kidins220 UTSW 12 25057000 missense probably benign 0.01
R7509:Kidins220 UTSW 12 24982361 missense probably damaging 0.98
R7510:Kidins220 UTSW 12 24992269 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCAGTATTCTGAGTACGTGATACG -3'
(R):5'- TCGAGAGCATGCTCAAGTCAG -3'

Sequencing Primer
(F):5'- ATTCTGAGTACGTGATACGATAATTG -3'
(R):5'- TGGGGACAGCAGCATATTCC -3'
Posted On2018-09-12