Incidental Mutation 'R6858:Serpina3k'
ID 535383
Institutional Source Beutler Lab
Gene Symbol Serpina3k
Ensembl Gene ENSMUSG00000058207
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 3K
Synonyms Spi-2, alpha-1 antiproteinase, MMSpi2, 1300001I07Rik, RP54, contrapsin, Spi2, MMCM2, D12Rp54
MMRRC Submission 044960-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6858 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 104304745-104311998 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104311504 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 361 (A361T)
Ref Sequence ENSEMBL: ENSMUSP00000042095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043058] [ENSMUST00000101078]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000043058
AA Change: A361T

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042095
Gene: ENSMUSG00000058207
AA Change: A361T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 57 417 4.77e-195 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101078
SMART Domains Protein: ENSMUSP00000098639
Gene: ENSMUSG00000079012

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Meta Mutation Damage Score 0.4598 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldob T C 4: 49,538,796 (GRCm39) T241A probably benign Het
Arid4a A G 12: 71,070,283 (GRCm39) I65V probably benign Het
Bhmt2 C T 13: 93,807,948 (GRCm39) E47K probably damaging Het
Bpifa3 G A 2: 153,979,514 (GRCm39) G213D probably benign Het
C4b C G 17: 34,948,805 (GRCm39) A1548P probably damaging Het
Ccdc39 A G 3: 33,874,017 (GRCm39) V605A probably damaging Het
Cept1 A T 3: 106,420,195 (GRCm39) probably null Het
Cntrl T C 2: 35,052,107 (GRCm39) probably null Het
Col3a1 A G 1: 45,385,144 (GRCm39) D87G probably damaging Het
Crim1 A T 17: 78,623,056 (GRCm39) E418V probably damaging Het
Crtac1 T C 19: 42,307,174 (GRCm39) I196M possibly damaging Het
Crtap T C 9: 114,209,084 (GRCm39) Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,452 (GRCm39) V27A probably damaging Het
Cyp2c69 G A 19: 39,866,009 (GRCm39) L195F probably benign Het
Cyp2d26 G A 15: 82,678,284 (GRCm39) R31C probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fign G T 2: 63,810,157 (GRCm39) T371K probably benign Het
Fryl T C 5: 73,222,375 (GRCm39) T2069A probably damaging Het
Gm3486 A G 14: 41,210,322 (GRCm39) I53T probably damaging Het
Gprc5d T C 6: 135,093,313 (GRCm39) N198S possibly damaging Het
Ighv1-42 A G 12: 114,900,966 (GRCm39) S40P probably damaging Het
Itga8 A G 2: 12,204,892 (GRCm39) V515A probably benign Het
Kidins220 A T 12: 25,058,542 (GRCm39) I523L possibly damaging Het
Lmx1a A T 1: 167,660,450 (GRCm39) N245I probably damaging Het
Med22 T C 2: 26,795,949 (GRCm39) D157G possibly damaging Het
Ola1 T C 2: 72,927,574 (GRCm39) H335R probably damaging Het
Or1a1 A T 11: 74,086,925 (GRCm39) M199L probably benign Het
Or4c12 A G 2: 89,774,087 (GRCm39) I124T probably damaging Het
Or6c213 A G 10: 129,574,333 (GRCm39) F151S probably damaging Het
Or7e166 T C 9: 19,624,765 (GRCm39) I214T probably damaging Het
Or8h9 A G 2: 86,789,034 (GRCm39) I256T probably benign Het
Pde1a T A 2: 79,959,502 (GRCm39) probably benign Het
Pdgfrb G A 18: 61,198,219 (GRCm39) G304D probably benign Het
Potegl T C 2: 23,102,676 (GRCm39) V138A possibly damaging Het
Prune2 T A 19: 17,095,470 (GRCm39) C325S possibly damaging Het
Ptk2b T C 14: 66,450,847 (GRCm39) I40V probably damaging Het
Qrich1 A G 9: 108,411,333 (GRCm39) D286G probably damaging Het
Scn5a T C 9: 119,321,156 (GRCm39) I1469V probably benign Het
Slc25a23 A G 17: 57,365,171 (GRCm39) Y73H probably damaging Het
Tmco3 A G 8: 13,363,924 (GRCm39) D82G probably damaging Het
Trbv28 G T 6: 41,248,624 (GRCm39) M51I probably damaging Het
Unc13b A T 4: 43,165,828 (GRCm39) H204L possibly damaging Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Vmn1r25 T C 6: 57,955,996 (GRCm39) S98G probably benign Het
Vmn2r2 A G 3: 64,044,915 (GRCm39) F77S probably damaging Het
Vmn2r79 A T 7: 86,686,580 (GRCm39) M654L probably benign Het
Zfp985 A T 4: 147,667,764 (GRCm39) K211* probably null Het
Zwilch C T 9: 64,060,869 (GRCm39) D328N probably damaging Het
Other mutations in Serpina3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Serpina3k APN 12 104,309,369 (GRCm39) missense probably benign 0.36
IGL01402:Serpina3k APN 12 104,306,882 (GRCm39) missense probably benign 0.00
IGL01404:Serpina3k APN 12 104,306,882 (GRCm39) missense probably benign 0.00
IGL01958:Serpina3k APN 12 104,307,316 (GRCm39) missense probably damaging 1.00
IGL02031:Serpina3k APN 12 104,311,525 (GRCm39) missense probably benign 0.08
IGL02055:Serpina3k APN 12 104,307,295 (GRCm39) nonsense probably null
IGL02981:Serpina3k APN 12 104,307,250 (GRCm39) missense probably benign 0.02
IGL03269:Serpina3k APN 12 104,306,780 (GRCm39) missense possibly damaging 0.83
R1076:Serpina3k UTSW 12 104,307,253 (GRCm39) missense probably benign 0.00
R2360:Serpina3k UTSW 12 104,307,166 (GRCm39) nonsense probably null
R3816:Serpina3k UTSW 12 104,307,221 (GRCm39) missense probably benign 0.08
R4577:Serpina3k UTSW 12 104,310,451 (GRCm39) missense possibly damaging 0.94
R4656:Serpina3k UTSW 12 104,311,532 (GRCm39) missense probably damaging 1.00
R4732:Serpina3k UTSW 12 104,307,119 (GRCm39) missense probably damaging 1.00
R4733:Serpina3k UTSW 12 104,307,119 (GRCm39) missense probably damaging 1.00
R4916:Serpina3k UTSW 12 104,309,269 (GRCm39) missense probably damaging 1.00
R4999:Serpina3k UTSW 12 104,307,305 (GRCm39) missense probably damaging 1.00
R5053:Serpina3k UTSW 12 104,309,473 (GRCm39) critical splice donor site probably null
R6300:Serpina3k UTSW 12 104,306,981 (GRCm39) missense probably damaging 1.00
R6343:Serpina3k UTSW 12 104,311,562 (GRCm39) missense probably benign
R6851:Serpina3k UTSW 12 104,311,625 (GRCm39) missense probably benign 0.00
R6872:Serpina3k UTSW 12 104,310,519 (GRCm39) missense probably benign 0.25
R6992:Serpina3k UTSW 12 104,307,366 (GRCm39) missense probably benign 0.00
R7025:Serpina3k UTSW 12 104,307,401 (GRCm39) missense probably benign 0.01
R7050:Serpina3k UTSW 12 104,307,403 (GRCm39) missense possibly damaging 0.96
R7238:Serpina3k UTSW 12 104,309,367 (GRCm39) missense probably damaging 1.00
R7240:Serpina3k UTSW 12 104,306,861 (GRCm39) missense probably benign 0.05
R7469:Serpina3k UTSW 12 104,311,594 (GRCm39) missense not run
R8837:Serpina3k UTSW 12 104,309,292 (GRCm39) missense probably benign 0.00
R9025:Serpina3k UTSW 12 104,307,230 (GRCm39) missense probably damaging 1.00
R9497:Serpina3k UTSW 12 104,309,430 (GRCm39) missense probably benign 0.01
X0019:Serpina3k UTSW 12 104,306,834 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATTCAGACACTGAGCAGACC -3'
(R):5'- AACTTGGTGAGCTTTAGGTCTAC -3'

Sequencing Primer
(F):5'- AGGGCCTGCCTCATCTCAC -3'
(R):5'- CTACTTGGGGTTATTGACTTTGGCC -3'
Posted On 2018-09-12