Incidental Mutation 'R6858:Ighv1-42'
ID535384
Institutional Source Beutler Lab
Gene Symbol Ighv1-42
Ensembl Gene ENSMUSG00000094652
Gene Nameimmunoglobulin heavy variable V1-42
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location114937113-114937544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114937346 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 40 (S40P)
Ref Sequence ENSEMBL: ENSMUSP00000142261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103516] [ENSMUST00000191868]
Predicted Effect probably damaging
Transcript: ENSMUST00000103516
AA Change: S21P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100297
Gene: ENSMUSG00000094652
AA Change: S21P

DomainStartEndE-ValueType
IGv 17 98 7.85e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191868
AA Change: S40P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142261
Gene: ENSMUSG00000094652
AA Change: S40P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 3.3e-31 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Ighv1-42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Ighv1-42 APN 12 114937184 missense probably damaging 1.00
IGL02143:Ighv1-42 APN 12 114937286 missense probably benign 0.35
IGL02336:Ighv1-42 APN 12 114937265 missense probably damaging 0.99
R4829:Ighv1-42 UTSW 12 114937168 missense probably benign 0.28
R5603:Ighv1-42 UTSW 12 114937512 unclassified probably benign
R6106:Ighv1-42 UTSW 12 114937287 missense probably benign 0.03
R6902:Ighv1-42 UTSW 12 114937535 missense possibly damaging 0.46
R6946:Ighv1-42 UTSW 12 114937535 missense possibly damaging 0.46
R6979:Ighv1-42 UTSW 12 114937228 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CTTGAGCTGCATGTAGGCTG -3'
(R):5'- ACACGGACTCTAACTATGGGATG -3'

Sequencing Primer
(F):5'- CTGTGCTGGAGGATTTGTCTAC -3'
(R):5'- CTCTAACTATGGGATGGAACTGGATC -3'
Posted On2018-09-12