Incidental Mutation 'R6858:Bhmt2'
ID535385
Institutional Source Beutler Lab
Gene Symbol Bhmt2
Ensembl Gene ENSMUSG00000042118
Gene Namebetaine-homocysteine methyltransferase 2
SynonymsC81077, D13Ucla2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93655720-93674302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93671440 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 47 (E47K)
Ref Sequence ENSEMBL: ENSMUSP00000015941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015941] [ENSMUST00000048001]
Predicted Effect probably damaging
Transcript: ENSMUST00000015941
AA Change: E47K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015941
Gene: ENSMUSG00000042118
AA Change: E47K

DomainStartEndE-ValueType
Pfam:S-methyl_trans 23 305 3.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048001
SMART Domains Protein: ENSMUSP00000039663
Gene: ENSMUSG00000042102

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DAO 44 407 9.3e-64 PFAM
Pfam:FAO_M 410 464 1e-15 PFAM
Pfam:GCV_T 468 738 3.6e-72 PFAM
Pfam:SoxG 559 697 1.3e-10 PFAM
Pfam:GCV_T_C 745 838 3.9e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homocysteine is a sulfur-containing amino acid that plays a crucial role in methylation reactions. Transfer of the methyl group from betaine to homocysteine creates methionine, which donates the methyl group to methylate DNA, proteins, lipids, and other intracellular metabolites. The protein encoded by this gene is one of two methyl transferases that can catalyze the transfer of the methyl group from betaine to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Bhmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Bhmt2 APN 13 93666771 splice site probably benign
IGL01665:Bhmt2 APN 13 93663153 nonsense probably null
IGL02059:Bhmt2 APN 13 93666663 missense probably benign
IGL02239:Bhmt2 APN 13 93663179 missense probably benign 0.00
IGL02267:Bhmt2 APN 13 93669346 missense probably damaging 1.00
IGL03148:Bhmt2 APN 13 93666653 missense possibly damaging 0.48
R1171:Bhmt2 UTSW 13 93662329 missense probably benign 0.00
R1517:Bhmt2 UTSW 13 93662339 missense probably damaging 0.97
R1886:Bhmt2 UTSW 13 93662490 missense probably benign 0.02
R2167:Bhmt2 UTSW 13 93662504 missense probably benign 0.29
R4024:Bhmt2 UTSW 13 93663331 splice site probably benign
R4823:Bhmt2 UTSW 13 93663290 missense probably benign
R5273:Bhmt2 UTSW 13 93666578 missense possibly damaging 0.84
R5333:Bhmt2 UTSW 13 93671430 missense probably benign 0.00
R5738:Bhmt2 UTSW 13 93663290 missense probably benign
R5955:Bhmt2 UTSW 13 93663197 missense probably benign 0.00
R6281:Bhmt2 UTSW 13 93663160 missense probably damaging 1.00
R6934:Bhmt2 UTSW 13 93662311 missense probably benign 0.18
R6985:Bhmt2 UTSW 13 93663322 missense possibly damaging 0.64
R7185:Bhmt2 UTSW 13 93663271 missense probably benign 0.22
R7639:Bhmt2 UTSW 13 93663314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTGCCATGACCTTCG -3'
(R):5'- GCCCAGAAACCATGCTATAATGTC -3'

Sequencing Primer
(F):5'- CGCTTCTTGGCAGTTCTGCAAG -3'
(R):5'- CAAGGCTGCCATTCTTAAAGTTTG -3'
Posted On2018-09-12