Incidental Mutation 'R6858:C4b'
ID535389
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 34729831 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 1548 (A1548P)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: A1548P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: A1548P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.8049 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Pdgfrb G A 18: 61,065,147 G304D probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7983:C4b UTSW 17 34739777 missense probably benign 0.03
R7991:C4b UTSW 17 34740352 missense probably benign 0.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGTGATCTAGAGAAAGGCGGC -3'
(R):5'- AAGTCATCAGAGGCCTTGGG -3'

Sequencing Primer
(F):5'- CAAGACATGAGGGCCTCTTG -3'
(R):5'- ACCAGATTTTAGAGTCTAGTGGCAG -3'
Posted On2018-09-12