Incidental Mutation 'R6858:Pdgfrb'
ID535392
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Nameplatelet derived growth factor receptor, beta polypeptide
SynonymsCD140b, Pdgfr
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6858 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61045150-61085061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61065147 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 304 (G304D)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
Predicted Effect probably benign
Transcript: ENSMUST00000025522
AA Change: G300D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: G300D

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115274
AA Change: G304D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: G304D

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (49/51)
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,212,664 V138A possibly damaging Het
Aldob T C 4: 49,538,796 T241A probably benign Het
Arid4a A G 12: 71,023,509 I65V probably benign Het
Bhmt2 C T 13: 93,671,440 E47K probably damaging Het
Bpifa3 G A 2: 154,137,594 G213D probably benign Het
C4b C G 17: 34,729,831 A1548P probably damaging Het
Ccdc39 A G 3: 33,819,868 V605A probably damaging Het
Cept1 A T 3: 106,512,879 probably null Het
Cntrl T C 2: 35,162,095 probably null Het
Col3a1 A G 1: 45,345,984 D87G probably damaging Het
Crim1 A T 17: 78,315,627 E418V probably damaging Het
Crtac1 T C 19: 42,318,735 I196M possibly damaging Het
Crtap T C 9: 114,380,016 Y320C probably damaging Het
Cttnbp2 A G 6: 18,448,453 V27A probably damaging Het
Cyp2c69 G A 19: 39,877,565 L195F probably benign Het
Cyp2d26 G A 15: 82,794,083 R31C probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fign G T 2: 63,979,813 T371K probably benign Het
Fryl T C 5: 73,065,032 T2069A probably damaging Het
Gm3486 A G 14: 41,488,365 I53T probably damaging Het
Gprc5d T C 6: 135,116,315 N198S possibly damaging Het
Ighv1-42 A G 12: 114,937,346 S40P probably damaging Het
Itga8 A G 2: 12,200,081 V515A probably benign Het
Kidins220 A T 12: 25,008,543 I523L possibly damaging Het
Lmx1a A T 1: 167,832,881 N245I probably damaging Het
Med22 T C 2: 26,905,937 D157G possibly damaging Het
Ola1 T C 2: 73,097,230 H335R probably damaging Het
Olfr1099 A G 2: 86,958,690 I256T probably benign Het
Olfr1259 A G 2: 89,943,743 I124T probably damaging Het
Olfr403 A T 11: 74,196,099 M199L probably benign Het
Olfr806 A G 10: 129,738,464 F151S probably damaging Het
Olfr857 T C 9: 19,713,469 I214T probably damaging Het
Pde1a T A 2: 80,129,158 probably benign Het
Prune2 T A 19: 17,118,106 C325S possibly damaging Het
Ptk2b T C 14: 66,213,398 I40V probably damaging Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Scn5a T C 9: 119,492,090 I1469V probably benign Het
Serpina3k G A 12: 104,345,245 A361T possibly damaging Het
Slc25a23 A G 17: 57,058,171 Y73H probably damaging Het
Tmco3 A G 8: 13,313,924 D82G probably damaging Het
Trbv29 G T 6: 41,271,690 M51I probably damaging Het
Unc13b A T 4: 43,165,828 H204L possibly damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn1r25 T C 6: 57,979,011 S98G probably benign Het
Vmn2r2 A G 3: 64,137,494 F77S probably damaging Het
Vmn2r79 A T 7: 87,037,372 M654L probably benign Het
Zfp985 A T 4: 147,583,307 K211* probably null Het
Zwilch C T 9: 64,153,587 D328N probably damaging Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61061513 missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61065880 nonsense probably null
R1740:Pdgfrb UTSW 18 61081833 missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1961:Pdgfrb UTSW 18 61061505 missense possibly damaging 0.49
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2011:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61077668 missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R7017:Pdgfrb UTSW 18 61081004 missense probably benign 0.00
R7089:Pdgfrb UTSW 18 61073243 missense probably damaging 1.00
R7174:Pdgfrb UTSW 18 61066515 missense probably benign
R7374:Pdgfrb UTSW 18 61071708 missense possibly damaging 0.64
R7496:Pdgfrb UTSW 18 61078932 missense possibly damaging 0.71
R7565:Pdgfrb UTSW 18 61083264 missense probably damaging 1.00
R7615:Pdgfrb UTSW 18 61064046 missense probably benign 0.00
R7691:Pdgfrb UTSW 18 61061268 missense probably benign 0.05
R7884:Pdgfrb UTSW 18 61072658 missense probably damaging 1.00
R8481:Pdgfrb UTSW 18 61065742 missense probably benign 0.03
R8735:Pdgfrb UTSW 18 61063977 missense probably benign 0.26
R8737:Pdgfrb UTSW 18 61081001 missense probably damaging 1.00
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGCCGGGCAAAGGTTG -3'
(R):5'- AATGAACTAGGCTCGGTGGG -3'

Sequencing Primer
(F):5'- GCAGGCTGCACATCTCAG -3'
(R):5'- ACTAGGCTCGGTGGGAAGTC -3'
Posted On2018-09-12