Incidental Mutation 'R6860:Fbn1'
ID535412
Institutional Source Beutler Lab
Gene Symbol Fbn1
Ensembl Gene ENSMUSG00000027204
Gene Namefibrillin 1
SynonymsFib-1
MMRRC Submission
Accession Numbers

Genbank: NM_007993; MGI: 95489

Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R6860 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location125300594-125507993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125328158 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1993 (N1993S)
Ref Sequence ENSEMBL: ENSMUSP00000099524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]
Predicted Effect probably damaging
Transcript: ENSMUST00000028633
AA Change: N1993S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: N1993S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 193 235 6.9e-17 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 343 388 2.3e-17 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 670 712 1.4e-17 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 862 902 2.1e-14 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 967 1009 3.9e-17 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1549 1590 3.5e-18 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1706 1749 9.7e-18 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2070 2112 3.7e-17 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2348 2391 8.5e-18 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103234
AA Change: N1993S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: N1993S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 194 232 3.5e-10 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 344 388 6.8e-15 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 671 712 8.3e-16 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 863 898 3.1e-8 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 968 1009 1.5e-15 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1550 1590 5.3e-17 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1707 1749 1.6e-16 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2071 2112 1.9e-15 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2349 2391 5.8e-15 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
MGI Phenotype Strain: 1934905; 4880665
Lethality: D7-D10
FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
9930012K11Rik C A 14: 70,157,622 V28L possibly damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
B4galt1 A T 4: 40,807,796 V335E probably benign Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dmtn T C 14: 70,614,882 T189A possibly damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
P3h3 A T 6: 124,857,368 V107D probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pcdhb3 C A 18: 37,301,710 T243K probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psd T A 19: 46,322,419 D397V probably damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Sec16a T C 2: 26,430,112 Y1438C probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Uso1 A G 5: 92,195,348 K764E probably benign Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in Fbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fbn1 APN 2 125324947 missense probably damaging 1.00
IGL00159:Fbn1 APN 2 125397873 missense probably benign 0.14
IGL00500:Fbn1 APN 2 125317516 missense probably damaging 0.99
IGL00558:Fbn1 APN 2 125329128 splice site probably benign
IGL00645:Fbn1 APN 2 125317103 splice site probably benign
IGL00863:Fbn1 APN 2 125403219 missense possibly damaging 0.84
IGL00926:Fbn1 APN 2 125319042 missense possibly damaging 0.84
IGL00935:Fbn1 APN 2 125377910 nonsense probably null
IGL00950:Fbn1 APN 2 125358823 missense probably damaging 1.00
IGL01090:Fbn1 APN 2 125394776 splice site probably benign
IGL01106:Fbn1 APN 2 125351706 missense possibly damaging 0.55
IGL01486:Fbn1 APN 2 125389978 missense probably benign 0.03
IGL01519:Fbn1 APN 2 125317019 missense probably benign 0.07
IGL01585:Fbn1 APN 2 125360110 missense probably damaging 0.98
IGL01730:Fbn1 APN 2 125312974 splice site probably benign
IGL01793:Fbn1 APN 2 125387293 missense possibly damaging 0.67
IGL01803:Fbn1 APN 2 125350287 missense probably damaging 1.00
IGL01803:Fbn1 APN 2 125301725 missense probably benign
IGL01916:Fbn1 APN 2 125315446 missense possibly damaging 0.55
IGL02035:Fbn1 APN 2 125335362 splice site probably null
IGL02097:Fbn1 APN 2 125363969 missense probably damaging 1.00
IGL02233:Fbn1 APN 2 125321610 splice site probably benign
IGL02512:Fbn1 APN 2 125338460 missense probably damaging 1.00
IGL02552:Fbn1 APN 2 125412713 missense possibly damaging 0.86
IGL02657:Fbn1 APN 2 125352025 missense possibly damaging 0.86
IGL02718:Fbn1 APN 2 125369886 missense probably damaging 1.00
IGL02863:Fbn1 APN 2 125303256 missense possibly damaging 0.80
IGL02974:Fbn1 APN 2 125346330 missense probably null 0.99
IGL03058:Fbn1 APN 2 125403200 missense probably benign 0.03
IGL03172:Fbn1 APN 2 125320968 missense possibly damaging 0.92
IGL03288:Fbn1 APN 2 125303183 missense probably benign 0.13
Carinatum UTSW 2 125342830 missense possibly damaging 0.70
lincoln UTSW 2 125403170 missense possibly damaging 0.50
reaper UTSW 2 125315404 missense probably damaging 0.98
Scythe UTSW 2 125403228 missense possibly damaging 0.84
string_bean UTSW 2 125379134 splice site probably null
wirey UTSW 2 125309495 missense probably benign
3-1:Fbn1 UTSW 2 125394605 splice site probably benign
P0012:Fbn1 UTSW 2 125369321 splice site probably benign
PIT4403001:Fbn1 UTSW 2 125342911 missense probably damaging 1.00
PIT4466001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4472001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4651001:Fbn1 UTSW 2 125363989 critical splice acceptor site probably null
R0226:Fbn1 UTSW 2 125320910 missense possibly damaging 0.86
R0310:Fbn1 UTSW 2 125363644 missense probably damaging 1.00
R0362:Fbn1 UTSW 2 125309777 missense probably damaging 0.99
R0374:Fbn1 UTSW 2 125321676 missense possibly damaging 0.86
R0433:Fbn1 UTSW 2 125348215 missense possibly damaging 0.95
R0441:Fbn1 UTSW 2 125309755 critical splice donor site probably null
R0501:Fbn1 UTSW 2 125301749 missense probably benign 0.23
R0510:Fbn1 UTSW 2 125342925 splice site probably benign
R0573:Fbn1 UTSW 2 125389249 missense probably damaging 0.99
R0622:Fbn1 UTSW 2 125379024 missense possibly damaging 0.88
R0630:Fbn1 UTSW 2 125394770 missense possibly damaging 0.48
R0724:Fbn1 UTSW 2 125352064 missense probably benign 0.14
R0739:Fbn1 UTSW 2 125367630 missense probably benign 0.18
R0744:Fbn1 UTSW 2 125314814 splice site probably benign
R0811:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0812:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0862:Fbn1 UTSW 2 125342891 nonsense probably null
R0864:Fbn1 UTSW 2 125342891 nonsense probably null
R1061:Fbn1 UTSW 2 125345963 missense probably benign 0.01
R1126:Fbn1 UTSW 2 125321192 splice site probably null
R1172:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1175:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1183:Fbn1 UTSW 2 125321617 missense probably benign 0.07
R1218:Fbn1 UTSW 2 125412749 missense possibly damaging 0.71
R1241:Fbn1 UTSW 2 125372527 splice site probably benign
R1248:Fbn1 UTSW 2 125301609 missense probably benign 0.01
R1345:Fbn1 UTSW 2 125314671 missense probably damaging 1.00
R1374:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1458:Fbn1 UTSW 2 125301929 missense probably benign 0.01
R1474:Fbn1 UTSW 2 125361265 missense possibly damaging 0.72
R1496:Fbn1 UTSW 2 125309495 missense probably benign
R1502:Fbn1 UTSW 2 125363706 nonsense probably null
R1511:Fbn1 UTSW 2 125306285 missense probably benign 0.00
R1588:Fbn1 UTSW 2 125319114 missense probably benign 0.19
R1626:Fbn1 UTSW 2 125341279 missense probably damaging 1.00
R1676:Fbn1 UTSW 2 125309781 missense probably damaging 1.00
R1712:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1772:Fbn1 UTSW 2 125403228 missense possibly damaging 0.84
R1776:Fbn1 UTSW 2 125321734 missense possibly damaging 0.71
R1869:Fbn1 UTSW 2 125352027 missense probably benign 0.00
R1894:Fbn1 UTSW 2 125394621 missense probably damaging 0.96
R1925:Fbn1 UTSW 2 125363629 missense probably damaging 1.00
R1957:Fbn1 UTSW 2 125367654 missense possibly damaging 0.93
R1995:Fbn1 UTSW 2 125350373 critical splice acceptor site probably null
R2140:Fbn1 UTSW 2 125343810 missense probably damaging 1.00
R2142:Fbn1 UTSW 2 125412708 missense possibly damaging 0.93
R2268:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R3409:Fbn1 UTSW 2 125412665 missense possibly damaging 0.92
R3418:Fbn1 UTSW 2 125320926 missense possibly damaging 0.55
R3508:Fbn1 UTSW 2 125306327 missense probably benign 0.19
R3778:Fbn1 UTSW 2 125317086 missense probably damaging 1.00
R3800:Fbn1 UTSW 2 125345974 missense possibly damaging 0.63
R4001:Fbn1 UTSW 2 125477495 critical splice donor site probably null
R4169:Fbn1 UTSW 2 125363952 missense possibly damaging 0.86
R4398:Fbn1 UTSW 2 125397781 missense probably benign 0.32
R4482:Fbn1 UTSW 2 125363610 critical splice donor site probably null
R4559:Fbn1 UTSW 2 125351714 missense possibly damaging 0.65
R4608:Fbn1 UTSW 2 125306500 missense probably benign 0.05
R4634:Fbn1 UTSW 2 125344061 missense probably damaging 1.00
R4706:Fbn1 UTSW 2 125370149 missense probably benign 0.21
R4712:Fbn1 UTSW 2 125341316 missense probably benign 0.12
R4783:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4784:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4785:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4793:Fbn1 UTSW 2 125321235 nonsense probably null
R4838:Fbn1 UTSW 2 125372399 missense probably benign 0.01
R4864:Fbn1 UTSW 2 125372397 missense possibly damaging 0.92
R4887:Fbn1 UTSW 2 125309774 missense probably damaging 1.00
R4942:Fbn1 UTSW 2 125383616 missense possibly damaging 0.88
R4952:Fbn1 UTSW 2 125317534 missense probably damaging 1.00
R5030:Fbn1 UTSW 2 125412704 missense possibly damaging 0.51
R5044:Fbn1 UTSW 2 125329102 missense probably damaging 0.97
R5057:Fbn1 UTSW 2 125466695 missense probably benign 0.33
R5115:Fbn1 UTSW 2 125332383 missense probably damaging 1.00
R5399:Fbn1 UTSW 2 125332333 missense possibly damaging 0.69
R5498:Fbn1 UTSW 2 125360176 missense probably damaging 1.00
R5526:Fbn1 UTSW 2 125365639 missense possibly damaging 0.83
R5529:Fbn1 UTSW 2 125373950 missense probably benign 0.01
R5602:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R5760:Fbn1 UTSW 2 125361247 missense probably damaging 1.00
R5837:Fbn1 UTSW 2 125379134 splice site probably null
R5955:Fbn1 UTSW 2 125358882 missense probably damaging 1.00
R5980:Fbn1 UTSW 2 125315404 missense probably damaging 0.98
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6058:Fbn1 UTSW 2 125466612 missense possibly damaging 0.73
R6089:Fbn1 UTSW 2 125321225 missense possibly damaging 0.55
R6136:Fbn1 UTSW 2 125403132 missense possibly damaging 0.63
R6161:Fbn1 UTSW 2 125369801 nonsense probably null
R6162:Fbn1 UTSW 2 125360227 missense probably damaging 1.00
R6165:Fbn1 UTSW 2 125332363 missense probably damaging 0.99
R6169:Fbn1 UTSW 2 125335489 critical splice acceptor site probably null
R6221:Fbn1 UTSW 2 125320921 missense probably benign 0.07
R6223:Fbn1 UTSW 2 125412671 missense possibly damaging 0.86
R6225:Fbn1 UTSW 2 125330543 missense probably damaging 1.00
R6238:Fbn1 UTSW 2 125324945 missense probably damaging 0.98
R6329:Fbn1 UTSW 2 125308473 missense possibly damaging 0.70
R6401:Fbn1 UTSW 2 125346450 missense probably damaging 0.98
R6480:Fbn1 UTSW 2 125335418 missense probably benign 0.05
R6513:Fbn1 UTSW 2 125383671 missense probably damaging 1.00
R6530:Fbn1 UTSW 2 125389270 missense probably damaging 0.99
R6595:Fbn1 UTSW 2 125342830 missense possibly damaging 0.70
R6781:Fbn1 UTSW 2 125317038 missense probably damaging 1.00
R6849:Fbn1 UTSW 2 125321691 missense possibly damaging 0.82
R6960:Fbn1 UTSW 2 125382060 missense probably benign 0.16
R7134:Fbn1 UTSW 2 125382049 missense probably benign 0.03
R7241:Fbn1 UTSW 2 125306495 missense possibly damaging 0.86
R7295:Fbn1 UTSW 2 125335487 missense probably damaging 1.00
R7312:Fbn1 UTSW 2 125466674 missense possibly damaging 0.53
R7322:Fbn1 UTSW 2 125479195 missense possibly damaging 0.92
R7349:Fbn1 UTSW 2 125315401 missense possibly damaging 0.84
R7365:Fbn1 UTSW 2 125352049 missense probably damaging 0.97
R7392:Fbn1 UTSW 2 125343924 missense probably damaging 1.00
R7442:Fbn1 UTSW 2 125403212 missense possibly damaging 0.45
R7452:Fbn1 UTSW 2 125505455 missense possibly damaging 0.53
R7453:Fbn1 UTSW 2 125320959 missense possibly damaging 0.93
R7457:Fbn1 UTSW 2 125351747 missense possibly damaging 0.90
R7458:Fbn1 UTSW 2 125319116 missense probably benign 0.14
R7549:Fbn1 UTSW 2 125344027 missense probably damaging 0.99
R7570:Fbn1 UTSW 2 125397852 missense probably benign 0.29
R7666:Fbn1 UTSW 2 125306471 missense probably damaging 1.00
R7723:Fbn1 UTSW 2 125382034 nonsense probably null
R7745:Fbn1 UTSW 2 125303195 missense probably benign 0.06
R7780:Fbn1 UTSW 2 125301758 missense probably benign 0.15
X0019:Fbn1 UTSW 2 125383643 missense possibly damaging 0.82
X0020:Fbn1 UTSW 2 125369340 missense probably damaging 1.00
X0028:Fbn1 UTSW 2 125342798 critical splice donor site probably null
X0067:Fbn1 UTSW 2 125369914 missense possibly damaging 0.95
Z1088:Fbn1 UTSW 2 125350288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTTCCTGCCTCGACAGAGTG -3'
(R):5'- TGGGAAGCTTTTACAGTAATGCC -3'

Sequencing Primer
(F):5'- GAGTGTGAGGTCATAAGCCATATTC -3'
(R):5'- GGAAGACTTGTGACTTTTAGCAAGCC -3'
Posted On2018-09-12