Incidental Mutation 'R6860:Uso1'
ID535425
Institutional Source Beutler Lab
Gene Symbol Uso1
Ensembl Gene ENSMUSG00000029407
Gene NameUSO1 vesicle docking factor
SynonymsVdp, TAP, transcytosis associated protein p115
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6860 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92137938-92202798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92195348 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 764 (K764E)
Ref Sequence ENSEMBL: ENSMUSP00000031355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]
Predicted Effect probably benign
Transcript: ENSMUST00000031355
AA Change: K764E

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: K764E

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 6.5e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
Pfam:Uso1_p115_C 782 954 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201642
SMART Domains Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
PDB:3GRL|A 1 52 5e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000202155
SMART Domains Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 5.7e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Pfam:Uso1_p115_C 730 892 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
9930012K11Rik C A 14: 70,157,622 V28L possibly damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
B4galt1 A T 4: 40,807,796 V335E probably benign Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dmtn T C 14: 70,614,882 T189A possibly damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 T C 2: 125,328,158 N1993S probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
P3h3 A T 6: 124,857,368 V107D probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pcdhb3 C A 18: 37,301,710 T243K probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psd T A 19: 46,322,419 D397V probably damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Sec16a T C 2: 26,430,112 Y1438C probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in Uso1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Uso1 APN 5 92181419 missense probably damaging 0.96
IGL01753:Uso1 APN 5 92152918 critical splice donor site probably null
IGL02311:Uso1 APN 5 92187776 missense probably benign
IGL02539:Uso1 APN 5 92187773 missense probably damaging 1.00
IGL02716:Uso1 APN 5 92173935 missense probably damaging 0.99
IGL03154:Uso1 APN 5 92180618 nonsense probably null
R0558:Uso1 UTSW 5 92174019 missense probably benign 0.03
R0570:Uso1 UTSW 5 92199823 missense probably benign 0.19
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1398:Uso1 UTSW 5 92181468 missense probably benign 0.16
R1485:Uso1 UTSW 5 92180563 missense possibly damaging 0.76
R1813:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1873:Uso1 UTSW 5 92192859 splice site probably benign
R1896:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1899:Uso1 UTSW 5 92201192 missense probably benign 0.27
R2049:Uso1 UTSW 5 92181936 missense probably damaging 1.00
R2128:Uso1 UTSW 5 92195370 missense probably benign
R2411:Uso1 UTSW 5 92158399 splice site probably benign
R2903:Uso1 UTSW 5 92195435 critical splice donor site probably null
R5055:Uso1 UTSW 5 92192735 missense probably benign 0.31
R5155:Uso1 UTSW 5 92167335 critical splice donor site probably null
R5590:Uso1 UTSW 5 92180608 missense probably benign 0.05
R5665:Uso1 UTSW 5 92198337 missense possibly damaging 0.95
R5677:Uso1 UTSW 5 92201299 missense probably damaging 1.00
R5996:Uso1 UTSW 5 92192730 missense probably benign 0.00
R6165:Uso1 UTSW 5 92187267 missense probably damaging 1.00
R6340:Uso1 UTSW 5 92199852 missense probably benign 0.01
R6701:Uso1 UTSW 5 92166585 missense probably damaging 1.00
R7062:Uso1 UTSW 5 92192740 missense possibly damaging 0.62
R7133:Uso1 UTSW 5 92158465 missense probably benign 0.12
R7317:Uso1 UTSW 5 92173992 missense possibly damaging 0.70
R7527:Uso1 UTSW 5 92199875 missense possibly damaging 0.58
R7648:Uso1 UTSW 5 92194002 splice site probably null
R7707:Uso1 UTSW 5 92201936 makesense probably null
R8009:Uso1 UTSW 5 92166580 missense probably benign 0.03
Z1177:Uso1 UTSW 5 92138130 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTGAGTGTAACTTCTGAGGC -3'
(R):5'- TGTCAAGTAAACACAGCTTCTAGG -3'

Sequencing Primer
(F):5'- AACTTCTGAGGCTGTGGAGAGC -3'
(R):5'- CACAGCTTCTAGGTTTTTCAAAGC -3'
Posted On2018-09-12