Mutagenetix > Incidental Mutation

Incidental Mutation 'R6860:Cntn6'

535432

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R6860 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104861946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 987 (E987V)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089215
AA Change: E987V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: E987V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161070
AA Change: E915V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: E915V

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162872
AA Change: E987V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: E987V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Meta Mutation Damage Score

0.0604

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,625,100	L58P	probably damaging	Het
4933427D14Rik	T	C	11: 72,189,586	E418G	probably damaging	Het
9930012K11Rik	C	A	14: 70,157,622	V28L	possibly damaging	Het
Abtb2	C	T	2: 103,709,425	R712*	probably null	Het
Acvr1c	C	T	2: 58,287,705	G171S	probably damaging	Het
Ahctf1	G	T	1: 179,753,288	A1783E	probably benign	Het
Anapc4	A	T	5: 52,848,828	Q149L	probably damaging	Het
Ankrd27	T	C	7: 35,628,527	V824A	possibly damaging	Het
Ankrd31	G	C	13: 96,831,586	C577S	probably benign	Het
Apol7c	T	C	15: 77,526,074	N224S	probably benign	Het
Arl14	A	T	3: 69,222,696	T59S	probably benign	Het
Astn1	T	A	1: 158,612,472	I870K	probably damaging	Het
B4galt1	A	T	4: 40,807,796	V335E	probably benign	Het
C2cd3	C	T	7: 100,390,241	P216S	probably benign	Het
Cchcr1	C	A	17: 35,529,118	N711K	possibly damaging	Het
Chd2	A	G	7: 73,497,810	F467L	possibly damaging	Het
Col11a2	T	A	17: 34,053,598	L286H	probably damaging	Het
Cwc22	C	T	2: 77,929,448	R85Q	possibly damaging	Het
Cyp7a1	A	C	4: 6,272,587	F209V	probably damaging	Het
Dmtn	T	C	14: 70,614,882	T189A	possibly damaging	Het
Dnhd1	C	G	7: 105,678,266	N777K	probably benign	Het
Dusp16	A	T	6: 134,725,879	C216*	probably null	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbn1	T	C	2: 125,328,158	N1993S	probably damaging	Het
Fbxw22	A	G	9: 109,383,962	S306P	probably benign	Het
Ferd3l	T	C	12: 33,928,652	S55P	probably benign	Het
Fpr-rs3	A	G	17: 20,624,298	S194P	possibly damaging	Het
Gm19965	G	A	1: 116,820,879	D97N	probably benign	Het
Gtpbp2	A	G	17: 46,167,988		probably benign	Het
Hcn3	A	C	3: 89,159,845	I72S	possibly damaging	Het
Hist1h3f	G	T	13: 23,544,590	V36L	probably benign	Het
Hk3	T	A	13: 55,014,465	N109Y	probably damaging	Het
Iqub	T	C	6: 24,505,738	E57G	possibly damaging	Het
Kcnk3	T	A	5: 30,622,053	M149K	possibly damaging	Het
Kcp	C	T	6: 29,505,720	G51D	probably benign	Het
Kif26a	C	A	12: 112,146,829	A53D	probably damaging	Het
Lifr	T	A	15: 7,172,937	I353K	probably benign	Het
Llph	A	T	10: 120,231,284	N102I	probably damaging	Het
Lmo3	C	A	6: 138,416,568	R18L	possibly damaging	Het
Lrrc46	T	C	11: 97,035,545	E175G	probably benign	Het
Ltk	A	T	2: 119,754,594	C128*	probably null	Het
Map1b	T	C	13: 99,434,767	E482G	probably damaging	Het
Mapk8ip2	T	C	15: 89,460,452	V740A	probably damaging	Het
Miga2	T	C	2: 30,371,163	W157R	probably benign	Het
Mlip	A	G	9: 77,102,393	*837Q	probably null	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Myl1	T	C	1: 66,945,058		probably benign	Het
Olfr365	T	C	2: 37,202,177	L312P	possibly damaging	Het
Olfr448	T	C	6: 42,896,816	Y122H	probably benign	Het
Olfr613	A	G	7: 103,551,868	I28V	probably benign	Het
P3h3	A	T	6: 124,857,368	V107D	probably benign	Het
Papolb	A	T	5: 142,528,896	S331T	possibly damaging	Het
Pars2	T	G	4: 106,654,503	V494G	probably benign	Het
Pcdhb3	C	A	18: 37,301,710	T243K	probably benign	Het
Pde9a	T	A	17: 31,470,724	M415K	probably damaging	Het
Ppp1r9b	G	A	11: 94,992,148	A201T	probably benign	Het
Prl	A	G	13: 27,064,959	N197S	possibly damaging	Het
Prl2c1	T	A	13: 27,851,741	M32K	probably benign	Het
Prrt4	T	C	6: 29,170,738	S572G	possibly damaging	Het
Psd	T	A	19: 46,322,419	D397V	probably damaging	Het
Psme2b	A	T	11: 48,945,480	Y213*	probably null	Het
Ptcd3	T	A	6: 71,897,110		probably null	Het
Ptprk	T	G	10: 28,334,484	F167L	probably damaging	Het
Rfx7	T	C	9: 72,616,944	V472A	probably damaging	Het
Scnn1g	T	C	7: 121,740,353	L125S	probably damaging	Het
Sec16a	T	C	2: 26,430,112	Y1438C	probably damaging	Het
Serinc3	C	T	2: 163,634,446	S155N	probably benign	Het
Slc3a2	A	T	19: 8,713,632	V78E	probably damaging	Het
Slc44a4	T	A	17: 34,921,068	L23Q	probably damaging	Het
Slco5a1	C	T	1: 12,881,196		probably benign	Het
Slit1	A	G	19: 41,616,715	M899T	probably benign	Het
Sorl1	A	G	9: 42,022,392	I1094T	probably benign	Het
Spag9	T	A	11: 94,081,370	L258Q	probably benign	Het
Strip1	T	C	3: 107,618,936	E488G	possibly damaging	Het
Stx18	G	A	5: 38,104,891	D30N	possibly damaging	Het
Sync	T	C	4: 129,287,790		probably null	Het
Syncrip	A	G	9: 88,476,796	V220A	probably damaging	Het
Tagln2	T	C	1: 172,505,909	I110T	probably benign	Het
Taok1	T	C	11: 77,541,801	T729A	probably benign	Het
Tgfbrap1	C	T	1: 43,067,599	V75I	possibly damaging	Het
Tnfrsf21	A	G	17: 43,017,066	T24A	probably benign	Het
Tnxb	T	A	17: 34,713,157	D2221E	probably damaging	Het
Triml1	A	G	8: 43,130,566	S333P	probably damaging	Het
Trp53bp1	C	A	2: 121,199,113	R1862L	probably damaging	Het
Tsc22d1	T	G	14: 76,418,292	I737S	possibly damaging	Het
U2af2	A	T	7: 5,079,274	K462N	possibly damaging	Het
Ubap2	A	C	4: 41,233,631	N86K	probably damaging	Het
Uso1	A	G	5: 92,195,348	K764E	probably benign	Het
Vmn1r192	T	A	13: 22,187,952	M33L	probably benign	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTCATCATAACAGCATCTG -3'
(R):5'- AACGCCTACCCATTGTTATGAG -3'

Sequencing Primer
(F):5'- TCATCATAACAGCATCTGAACCCTC -3'
(R):5'- GAAAAACTGGCTTGTCACTTTTGGC -3'

Posted On

2018-09-12