Mutagenetix > Incidental Mutation

Incidental Mutation 'R6860:Dnhd1'

535442

Institutional Source

Beutler Lab

Gene Symbol

Dnhd1

Ensembl Gene

ENSMUSG00000030882

Gene Name

dynein heavy chain domain 1

Synonyms

8030491N06Rik

MMRRC Submission

Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2: ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R6860 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105650827-105721799 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 105678266 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 777 (N777K)

Ref Sequence

ENSEMBL: ENSMUSP00000121261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106776] [ENSMUST00000142874] [ENSMUST00000145988] [ENSMUST00000210312]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000106776
AA Change: N39K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102388
Gene: ENSMUSG00000030882
AA Change: N39K

Domain	Start	End	E-Value	Type
low complexity region	205	224	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142874

Predicted Effect

probably benign
Transcript: ENSMUST00000145988
AA Change: N777K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: N777K

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
low complexity region	253	269	N/A	INTRINSIC
low complexity region	943	962	N/A	INTRINSIC
Pfam:DHC_N2	1018	1472	4.6e-50	PFAM
Pfam:AAA_6	1652	1875	2.7e-14	PFAM
low complexity region	1906	1918	N/A	INTRINSIC
Blast:AAA	1993	2196	1e-34	BLAST
Pfam:AAA_7	2362	2610	3.3e-11	PFAM
low complexity region	2697	2714	N/A	INTRINSIC
low complexity region	2722	2733	N/A	INTRINSIC
low complexity region	2800	2810	N/A	INTRINSIC
low complexity region	3116	3134	N/A	INTRINSIC
Pfam:MT	3178	3470	3.9e-16	PFAM
coiled coil region	3590	3642	N/A	INTRINSIC
coiled coil region	3816	3843	N/A	INTRINSIC
Pfam:Dynein_heavy	3976	4746	7.3e-97	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000210312

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (86/86)

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,625,100	L58P	probably damaging	Het
4933427D14Rik	T	C	11: 72,189,586	E418G	probably damaging	Het
9930012K11Rik	C	A	14: 70,157,622	V28L	possibly damaging	Het
Abtb2	C	T	2: 103,709,425	R712*	probably null	Het
Acvr1c	C	T	2: 58,287,705	G171S	probably damaging	Het
Ahctf1	G	T	1: 179,753,288	A1783E	probably benign	Het
Anapc4	A	T	5: 52,848,828	Q149L	probably damaging	Het
Ankrd27	T	C	7: 35,628,527	V824A	possibly damaging	Het
Ankrd31	G	C	13: 96,831,586	C577S	probably benign	Het
Apol7c	T	C	15: 77,526,074	N224S	probably benign	Het
Arl14	A	T	3: 69,222,696	T59S	probably benign	Het
Astn1	T	A	1: 158,612,472	I870K	probably damaging	Het
B4galt1	A	T	4: 40,807,796	V335E	probably benign	Het
C2cd3	C	T	7: 100,390,241	P216S	probably benign	Het
Cchcr1	C	A	17: 35,529,118	N711K	possibly damaging	Het
Chd2	A	G	7: 73,497,810	F467L	possibly damaging	Het
Cntn6	A	T	6: 104,861,946	E987V	possibly damaging	Het
Col11a2	T	A	17: 34,053,598	L286H	probably damaging	Het
Cwc22	C	T	2: 77,929,448	R85Q	possibly damaging	Het
Cyp7a1	A	C	4: 6,272,587	F209V	probably damaging	Het
Dmtn	T	C	14: 70,614,882	T189A	possibly damaging	Het
Dusp16	A	T	6: 134,725,879	C216*	probably null	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbn1	T	C	2: 125,328,158	N1993S	probably damaging	Het
Fbxw22	A	G	9: 109,383,962	S306P	probably benign	Het
Ferd3l	T	C	12: 33,928,652	S55P	probably benign	Het
Fpr-rs3	A	G	17: 20,624,298	S194P	possibly damaging	Het
Gm19965	G	A	1: 116,820,879	D97N	probably benign	Het
Gtpbp2	A	G	17: 46,167,988		probably benign	Het
Hcn3	A	C	3: 89,159,845	I72S	possibly damaging	Het
Hist1h3f	G	T	13: 23,544,590	V36L	probably benign	Het
Hk3	T	A	13: 55,014,465	N109Y	probably damaging	Het
Iqub	T	C	6: 24,505,738	E57G	possibly damaging	Het
Kcnk3	T	A	5: 30,622,053	M149K	possibly damaging	Het
Kcp	C	T	6: 29,505,720	G51D	probably benign	Het
Kif26a	C	A	12: 112,146,829	A53D	probably damaging	Het
Lifr	T	A	15: 7,172,937	I353K	probably benign	Het
Llph	A	T	10: 120,231,284	N102I	probably damaging	Het
Lmo3	C	A	6: 138,416,568	R18L	possibly damaging	Het
Lrrc46	T	C	11: 97,035,545	E175G	probably benign	Het
Ltk	A	T	2: 119,754,594	C128*	probably null	Het
Map1b	T	C	13: 99,434,767	E482G	probably damaging	Het
Mapk8ip2	T	C	15: 89,460,452	V740A	probably damaging	Het
Miga2	T	C	2: 30,371,163	W157R	probably benign	Het
Mlip	A	G	9: 77,102,393	*837Q	probably null	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Myl1	T	C	1: 66,945,058		probably benign	Het
Olfr365	T	C	2: 37,202,177	L312P	possibly damaging	Het
Olfr448	T	C	6: 42,896,816	Y122H	probably benign	Het
Olfr613	A	G	7: 103,551,868	I28V	probably benign	Het
P3h3	A	T	6: 124,857,368	V107D	probably benign	Het
Papolb	A	T	5: 142,528,896	S331T	possibly damaging	Het
Pars2	T	G	4: 106,654,503	V494G	probably benign	Het
Pcdhb3	C	A	18: 37,301,710	T243K	probably benign	Het
Pde9a	T	A	17: 31,470,724	M415K	probably damaging	Het
Ppp1r9b	G	A	11: 94,992,148	A201T	probably benign	Het
Prl	A	G	13: 27,064,959	N197S	possibly damaging	Het
Prl2c1	T	A	13: 27,851,741	M32K	probably benign	Het
Prrt4	T	C	6: 29,170,738	S572G	possibly damaging	Het
Psd	T	A	19: 46,322,419	D397V	probably damaging	Het
Psme2b	A	T	11: 48,945,480	Y213*	probably null	Het
Ptcd3	T	A	6: 71,897,110		probably null	Het
Ptprk	T	G	10: 28,334,484	F167L	probably damaging	Het
Rfx7	T	C	9: 72,616,944	V472A	probably damaging	Het
Scnn1g	T	C	7: 121,740,353	L125S	probably damaging	Het
Sec16a	T	C	2: 26,430,112	Y1438C	probably damaging	Het
Serinc3	C	T	2: 163,634,446	S155N	probably benign	Het
Slc3a2	A	T	19: 8,713,632	V78E	probably damaging	Het
Slc44a4	T	A	17: 34,921,068	L23Q	probably damaging	Het
Slco5a1	C	T	1: 12,881,196		probably benign	Het
Slit1	A	G	19: 41,616,715	M899T	probably benign	Het
Sorl1	A	G	9: 42,022,392	I1094T	probably benign	Het
Spag9	T	A	11: 94,081,370	L258Q	probably benign	Het
Strip1	T	C	3: 107,618,936	E488G	possibly damaging	Het
Stx18	G	A	5: 38,104,891	D30N	possibly damaging	Het
Sync	T	C	4: 129,287,790		probably null	Het
Syncrip	A	G	9: 88,476,796	V220A	probably damaging	Het
Tagln2	T	C	1: 172,505,909	I110T	probably benign	Het
Taok1	T	C	11: 77,541,801	T729A	probably benign	Het
Tgfbrap1	C	T	1: 43,067,599	V75I	possibly damaging	Het
Tnfrsf21	A	G	17: 43,017,066	T24A	probably benign	Het
Tnxb	T	A	17: 34,713,157	D2221E	probably damaging	Het
Triml1	A	G	8: 43,130,566	S333P	probably damaging	Het
Trp53bp1	C	A	2: 121,199,113	R1862L	probably damaging	Het
Tsc22d1	T	G	14: 76,418,292	I737S	possibly damaging	Het
U2af2	A	T	7: 5,079,274	K462N	possibly damaging	Het
Ubap2	A	C	4: 41,233,631	N86K	probably damaging	Het
Uso1	A	G	5: 92,195,348	K764E	probably benign	Het
Vmn1r192	T	A	13: 22,187,952	M33L	probably benign	Het

Other mutations in Dnhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Dnhd1	APN	7	105677995	missense	probably damaging	1.00
IGL00516:Dnhd1	APN	7	105657211	missense	possibly damaging	0.52
IGL00576:Dnhd1	APN	7	105692675	missense	probably damaging	1.00
IGL00990:Dnhd1	APN	7	105721688	missense	possibly damaging	0.85
IGL01346:Dnhd1	APN	7	105713909	missense	probably benign
IGL01714:Dnhd1	APN	7	105720942	missense	probably damaging	1.00
IGL01735:Dnhd1	APN	7	105713754	missense	probably benign	0.37
IGL01814:Dnhd1	APN	7	105652030	missense	probably benign
IGL01999:Dnhd1	APN	7	105721215	missense	possibly damaging	0.50
IGL02022:Dnhd1	APN	7	105678309	missense	probably damaging	1.00
IGL02131:Dnhd1	APN	7	105720802	missense	probably damaging	1.00
IGL02156:Dnhd1	APN	7	105721744	missense	probably damaging	1.00
IGL02674:Dnhd1	APN	7	105721481	missense	probably benign	0.00
IGL02966:Dnhd1	APN	7	105720741	missense	probably benign	0.00
IGL03066:Dnhd1	APN	7	105719882	missense	probably damaging	0.99
IGL03298:Dnhd1	APN	7	105714475	missense	probably damaging	0.98
IGL03378:Dnhd1	APN	7	105713733	missense	possibly damaging	0.87
IGL02802:Dnhd1	UTSW	7	105655723	missense	possibly damaging	0.83
R0060:Dnhd1	UTSW	7	105668514	missense	probably damaging	0.99
R0129:Dnhd1	UTSW	7	105720924	missense	probably benign	0.19
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0384:Dnhd1	UTSW	7	105720114	missense	possibly damaging	0.56
R0453:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R0540:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0554:Dnhd1	UTSW	7	105694395	missense	probably benign	0.10
R0576:Dnhd1	UTSW	7	105714045	missense	probably damaging	1.00
R0607:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0631:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R0639:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0668:Dnhd1	UTSW	7	105695751	missense	probably benign
R0669:Dnhd1	UTSW	7	105693704	missense	probably benign	0.01
R0670:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0699:Dnhd1	UTSW	7	105651906	missense	probably damaging	0.98
R1019:Dnhd1	UTSW	7	105709171	missense	probably damaging	1.00
R1144:Dnhd1	UTSW	7	105713031	missense	probably damaging	1.00
R1226:Dnhd1	UTSW	7	105696899	missense	probably damaging	1.00
R1257:Dnhd1	UTSW	7	105694153	missense	probably damaging	1.00
R1391:Dnhd1	UTSW	7	105720124	missense	probably damaging	1.00
R1453:Dnhd1	UTSW	7	105721273	critical splice donor site	probably null
R1501:Dnhd1	UTSW	7	105668463	missense	probably benign	0.00
R1503:Dnhd1	UTSW	7	105693660	missense	possibly damaging	0.67
R1515:Dnhd1	UTSW	7	105704148	missense	probably benign	0.11
R1615:Dnhd1	UTSW	7	105703206	missense	probably benign	0.00
R1615:Dnhd1	UTSW	7	105713706	missense	possibly damaging	0.74
R1656:Dnhd1	UTSW	7	105714281	missense	probably damaging	1.00
R1720:Dnhd1	UTSW	7	105693828	missense	probably benign
R1723:Dnhd1	UTSW	7	105714920	missense	possibly damaging	0.60
R1766:Dnhd1	UTSW	7	105693972	missense	possibly damaging	0.50
R1799:Dnhd1	UTSW	7	105655767	missense	probably benign	0.31
R1860:Dnhd1	UTSW	7	105704205	missense	probably benign
R1920:Dnhd1	UTSW	7	105713407	missense	probably benign	0.00
R1925:Dnhd1	UTSW	7	105652252	missense	probably damaging	1.00
R1925:Dnhd1	UTSW	7	105673854	missense	probably damaging	0.96
R1934:Dnhd1	UTSW	7	105708582	missense	probably benign	0.05
R1935:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R1936:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R2035:Dnhd1	UTSW	7	105704921	missense	probably damaging	0.99
R2125:Dnhd1	UTSW	7	105677971	missense	probably benign	0.35
R2127:Dnhd1	UTSW	7	105693721	missense	possibly damaging	0.56
R2254:Dnhd1	UTSW	7	105703772	missense	probably damaging	1.00
R2301:Dnhd1	UTSW	7	105705399	missense	probably damaging	1.00
R2316:Dnhd1	UTSW	7	105674421	missense	probably damaging	1.00
R2324:Dnhd1	UTSW	7	105710090	missense	probably damaging	1.00
R2337:Dnhd1	UTSW	7	105703467	missense	probably benign	0.07
R2381:Dnhd1	UTSW	7	105693664	missense	probably benign	0.42
R2394:Dnhd1	UTSW	7	105720231	missense	probably benign	0.19
R2862:Dnhd1	UTSW	7	105712559	missense	probably benign	0.01
R3038:Dnhd1	UTSW	7	105720229	missense	probably damaging	0.99
R3114:Dnhd1	UTSW	7	105696565	critical splice donor site	probably null
R3404:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3405:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3439:Dnhd1	UTSW	7	105694785	missense	probably damaging	1.00
R3959:Dnhd1	UTSW	7	105713122	missense	probably benign	0.21
R4014:Dnhd1	UTSW	7	105714838	missense	probably damaging	0.99
R4084:Dnhd1	UTSW	7	105709588	missense	probably damaging	1.00
R4181:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4255:Dnhd1	UTSW	7	105712998	missense	probably damaging	1.00
R4302:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4440:Dnhd1	UTSW	7	105696728	nonsense	probably null
R4565:Dnhd1	UTSW	7	105651956	missense	possibly damaging	0.92
R4569:Dnhd1	UTSW	7	105657166	splice site	probably null
R4584:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4586:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4590:Dnhd1	UTSW	7	105714030	missense	probably damaging	1.00
R4593:Dnhd1	UTSW	7	105715446	missense	probably benign	0.02
R4600:Dnhd1	UTSW	7	105703644	missense	probably damaging	1.00
R4705:Dnhd1	UTSW	7	105655741	missense	probably damaging	1.00
R4731:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4732:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4733:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4786:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R4791:Dnhd1	UTSW	7	105721117	missense	probably damaging	1.00
R4811:Dnhd1	UTSW	7	105714281	missense	probably damaging	0.99
R4822:Dnhd1	UTSW	7	105703964	missense	probably benign	0.00
R4886:Dnhd1	UTSW	7	105714808	missense	probably benign	0.00
R4890:Dnhd1	UTSW	7	105656957	missense	possibly damaging	0.47
R4973:Dnhd1	UTSW	7	105713633	missense	probably benign	0.24
R5007:Dnhd1	UTSW	7	105713076	missense	probably damaging	1.00
R5048:Dnhd1	UTSW	7	105693697	missense	probably benign	0.01
R5151:Dnhd1	UTSW	7	105713440	missense	probably benign	0.22
R5179:Dnhd1	UTSW	7	105714552	missense	probably damaging	1.00
R5182:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5183:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5185:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5209:Dnhd1	UTSW	7	105696460	missense	probably benign	0.00
R5225:Dnhd1	UTSW	7	105703923	missense	possibly damaging	0.73
R5250:Dnhd1	UTSW	7	105685761	missense	probably damaging	1.00
R5257:Dnhd1	UTSW	7	105674037	missense	probably benign
R5258:Dnhd1	UTSW	7	105674037	missense	probably benign
R5273:Dnhd1	UTSW	7	105714482	missense	probably damaging	0.99
R5288:Dnhd1	UTSW	7	105714437	missense	possibly damaging	0.94
R5396:Dnhd1	UTSW	7	105713684	missense	probably benign	0.00
R5453:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R5511:Dnhd1	UTSW	7	105714156	missense	probably damaging	1.00
R5518:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5523:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5528:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5529:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5561:Dnhd1	UTSW	7	105714821	missense	probably damaging	0.99
R5681:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5682:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5683:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5684:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5686:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5697:Dnhd1	UTSW	7	105674188	missense	probably damaging	1.00
R5789:Dnhd1	UTSW	7	105705010	missense	possibly damaging	0.50
R5790:Dnhd1	UTSW	7	105655774	missense	probably damaging	1.00
R5814:Dnhd1	UTSW	7	105719895	missense	possibly damaging	0.69
R5828:Dnhd1	UTSW	7	105720181	missense	probably benign	0.00
R5852:Dnhd1	UTSW	7	105695748	missense	probably damaging	1.00
R5883:Dnhd1	UTSW	7	105720504	missense	probably damaging	0.98
R6115:Dnhd1	UTSW	7	105713987	missense	probably benign	0.00
R6119:Dnhd1	UTSW	7	105709440	missense	probably benign	0.18
R6212:Dnhd1	UTSW	7	105704048	missense	probably damaging	1.00
R6243:Dnhd1	UTSW	7	105652009	missense	probably damaging	1.00
R6265:Dnhd1	UTSW	7	105693370	missense	probably benign	0.07
R6332:Dnhd1	UTSW	7	105694066	missense	probably benign	0.02
R6344:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R6477:Dnhd1	UTSW	7	105677886	missense	probably benign	0.05
R6642:Dnhd1	UTSW	7	105703799	missense	probably benign
R6663:Dnhd1	UTSW	7	105685692	splice site	probably null
R6730:Dnhd1	UTSW	7	105703875	missense	probably benign	0.00
R6748:Dnhd1	UTSW	7	105720637	missense	probably benign	0.03
R6833:Dnhd1	UTSW	7	105703373	missense	probably benign	0.01
R6850:Dnhd1	UTSW	7	105719930	missense	possibly damaging	0.68
R6853:Dnhd1	UTSW	7	105703728	missense	probably benign
R6898:Dnhd1	UTSW	7	105687377	missense	probably damaging	0.99
R6927:Dnhd1	UTSW	7	105715563	missense	probably damaging	1.00
R6952:Dnhd1	UTSW	7	105713688	missense	probably damaging	1.00
R6987:Dnhd1	UTSW	7	105704585	missense	probably damaging	0.98
R6988:Dnhd1	UTSW	7	105714210	missense	probably damaging	1.00
R7022:Dnhd1	UTSW	7	105720798	missense	probably benign	0.36
R7053:Dnhd1	UTSW	7	105694954	missense	probably damaging	1.00
R7085:Dnhd1	UTSW	7	105715261	missense	probably benign	0.26
R7086:Dnhd1	UTSW	7	105708532	missense	probably benign	0.03
R7112:Dnhd1	UTSW	7	105713985	missense	probably damaging	1.00
R7140:Dnhd1	UTSW	7	105693766	missense	probably benign	0.00
R7151:Dnhd1	UTSW	7	105710027	missense	probably benign	0.03
R7178:Dnhd1	UTSW	7	105694993	missense	probably damaging	0.98
R7326:Dnhd1	UTSW	7	105720930	missense	probably damaging	0.96
R7345:Dnhd1	UTSW	7	105703967	missense	probably benign	0.17
R7349:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R7397:Dnhd1	UTSW	7	105705297	missense	possibly damaging	0.87
R7520:Dnhd1	UTSW	7	105696048	missense	probably benign	0.07
R7536:Dnhd1	UTSW	7	105709561	missense	probably damaging	1.00
R7539:Dnhd1	UTSW	7	105720912	missense	probably damaging	1.00
R7541:Dnhd1	UTSW	7	105678309	missense	probably damaging	1.00
R7619:Dnhd1	UTSW	7	105674268	missense	probably benign	0.01
R7676:Dnhd1	UTSW	7	105684087	missense	probably benign	0.09
R7689:Dnhd1	UTSW	7	105713963	missense	probably benign	0.07
R7712:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R7729:Dnhd1	UTSW	7	105705265	missense	probably damaging	1.00
R7767:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R7768:Dnhd1	UTSW	7	105721095	missense	possibly damaging	0.87
R7779:Dnhd1	UTSW	7	105677915	missense	probably benign	0.01
R7879:Dnhd1	UTSW	7	105703439	missense	probably benign	0.09
R7922:Dnhd1	UTSW	7	105668514	missense	probably damaging	1.00
R7951:Dnhd1	UTSW	7	105678004	missense	probably damaging	1.00
R8259:Dnhd1	UTSW	7	105694788	missense	probably benign	0.38
R8350:Dnhd1	UTSW	7	105678024	missense	probably damaging	0.99
R8380:Dnhd1	UTSW	7	105677866	missense	probably benign	0.31
R8392:Dnhd1	UTSW	7	105703343	missense	possibly damaging	0.84
R8478:Dnhd1	UTSW	7	105682794	missense	probably benign	0.00
R8708:Dnhd1	UTSW	7	105694280	nonsense	probably null
R8767:Dnhd1	UTSW	7	105652123	missense	probably damaging	1.00
R8825:Dnhd1	UTSW	7	105693967	missense	possibly damaging	0.95
R8849:Dnhd1	UTSW	7	105721516	missense	probably benign	0.00
R8903:Dnhd1	UTSW	7	105713648	nonsense	probably null
R8910:Dnhd1	UTSW	7	105683697	missense	possibly damaging	0.92
R8940:Dnhd1	UTSW	7	105714647	intron	probably benign
R8954:Dnhd1	UTSW	7	105694779	missense	probably benign	0.35
R8956:Dnhd1	UTSW	7	105692645	missense	probably damaging	0.99
R8971:Dnhd1	UTSW	7	105709321	nonsense	probably null
R8996:Dnhd1	UTSW	7	105674035	missense	probably damaging	1.00
R9051:Dnhd1	UTSW	7	105692726	missense	possibly damaging	0.54
R9058:Dnhd1	UTSW	7	105684063	missense	probably benign	0.01
R9109:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9284:Dnhd1	UTSW	7	105651884	missense	probably damaging	1.00
R9295:Dnhd1	UTSW	7	105714141	missense	probably benign
R9298:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9299:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9308:Dnhd1	UTSW	7	105704277	missense	probably damaging	1.00
R9337:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9385:Dnhd1	UTSW	7	105712765	missense	probably damaging	1.00
R9463:Dnhd1	UTSW	7	105657247	missense	probably benign	0.00
R9463:Dnhd1	UTSW	7	105695016	missense	probably benign
R9476:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9489:Dnhd1	UTSW	7	105651597	missense	probably benign
R9500:Dnhd1	UTSW	7	105704502	missense	probably benign
R9510:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9513:Dnhd1	UTSW	7	105704972	missense	probably damaging	1.00
R9537:Dnhd1	UTSW	7	105695533	missense	probably damaging	0.99
R9567:Dnhd1	UTSW	7	105704266	missense	probably benign	0.03
R9622:Dnhd1	UTSW	7	105704135	missense	probably benign
R9623:Dnhd1	UTSW	7	105686566	missense	probably damaging	1.00
R9623:Dnhd1	UTSW	7	105694927	missense	probably damaging	1.00
R9674:Dnhd1	UTSW	7	105714222	missense	probably damaging	1.00
R9756:Dnhd1	UTSW	7	105703928	missense	probably benign	0.19
R9777:Dnhd1	UTSW	7	105720249	missense	probably benign	0.14
R9778:Dnhd1	UTSW	7	105704033	missense	probably benign
R9781:Dnhd1	UTSW	7	105703710	missense	probably benign	0.31
R9796:Dnhd1	UTSW	7	105693330	missense	probably damaging	1.00
Z1088:Dnhd1	UTSW	7	105712727	missense	probably benign	0.00
Z1176:Dnhd1	UTSW	7	105668547	missense	probably damaging	0.98
Z1176:Dnhd1	UTSW	7	105678299	missense	probably benign
Z1176:Dnhd1	UTSW	7	105703036	critical splice acceptor site	probably null
Z1176:Dnhd1	UTSW	7	105703580	frame shift	probably null
Z1177:Dnhd1	UTSW	7	105682841	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCACTCTTGGAGGTGAGAGC -3'
(R):5'- TTCTAGCCCCATGGTAACCC -3'

Sequencing Primer
(F):5'- AGGAATTGGCTGCTGGC -3'
(R):5'- CATGTGCATGGATGTATGGAGG -3'

Posted On

2018-09-12