Incidental Mutation 'R6860:Fbxw22'
ID 535449
Institutional Source Beutler Lab
Gene Symbol Fbxw22
Ensembl Gene ENSMUSG00000070324
Gene Name F-box and WD-40 domain protein 22
Synonyms Gm5164
MMRRC Submission 045025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6860 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 109207468-109233362 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109213030 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 306 (S306P)
Ref Sequence ENSEMBL: ENSMUSP00000079460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080626] [ENSMUST00000197213]
AlphaFold Q5XG67
Predicted Effect probably benign
Transcript: ENSMUST00000080626
AA Change: S306P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079460
Gene: ENSMUSG00000070324
AA Change: S306P

DomainStartEndE-ValueType
FBOX 5 45 1.02e-5 SMART
SCOP:d1gxra_ 128 220 1e-5 SMART
Blast:WD40 137 176 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197213
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,080,412 (GRCm39) E418G probably damaging Het
9930012K11Rik C A 14: 70,395,071 (GRCm39) V28L possibly damaging Het
Abtb2 C T 2: 103,539,770 (GRCm39) R712* probably null Het
Acvr1c C T 2: 58,177,717 (GRCm39) G171S probably damaging Het
Ahctf1 G T 1: 179,580,853 (GRCm39) A1783E probably benign Het
Anapc4 A T 5: 53,006,170 (GRCm39) Q149L probably damaging Het
Ankrd27 T C 7: 35,327,952 (GRCm39) V824A possibly damaging Het
Ankrd31 G C 13: 96,968,094 (GRCm39) C577S probably benign Het
Apol7c T C 15: 77,410,274 (GRCm39) N224S probably benign Het
Arl14 A T 3: 69,130,029 (GRCm39) T59S probably benign Het
Astn1 T A 1: 158,440,042 (GRCm39) I870K probably damaging Het
B4galt1 A T 4: 40,807,796 (GRCm39) V335E probably benign Het
C2cd3 C T 7: 100,039,448 (GRCm39) P216S probably benign Het
Cchcr1 C A 17: 35,840,015 (GRCm39) N711K possibly damaging Het
Chd2 A G 7: 73,147,558 (GRCm39) F467L possibly damaging Het
Cntn6 A T 6: 104,838,907 (GRCm39) E987V possibly damaging Het
Col11a2 T A 17: 34,272,572 (GRCm39) L286H probably damaging Het
Cwc22 C T 2: 77,759,792 (GRCm39) R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 (GRCm39) F209V probably damaging Het
Dmtn T C 14: 70,852,322 (GRCm39) T189A possibly damaging Het
Dnhd1 C G 7: 105,327,473 (GRCm39) N777K probably benign Het
Dusp16 A T 6: 134,702,842 (GRCm39) C216* probably null Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fbn1 T C 2: 125,170,078 (GRCm39) N1993S probably damaging Het
Ferd3l T C 12: 33,978,651 (GRCm39) S55P probably benign Het
Fpr-rs3 A G 17: 20,844,560 (GRCm39) S194P possibly damaging Het
Gm19965 G A 1: 116,748,609 (GRCm39) D97N probably benign Het
Gtpbp2 A G 17: 46,478,914 (GRCm39) probably benign Het
H3c7 G T 13: 23,728,760 (GRCm39) V36L probably benign Het
Hcn3 A C 3: 89,067,152 (GRCm39) I72S possibly damaging Het
Hk3 T A 13: 55,162,278 (GRCm39) N109Y probably damaging Het
Iqub T C 6: 24,505,737 (GRCm39) E57G possibly damaging Het
Kcnk3 T A 5: 30,779,397 (GRCm39) M149K possibly damaging Het
Kcp C T 6: 29,505,719 (GRCm39) G51D probably benign Het
Kif26a C A 12: 112,113,263 (GRCm39) A53D probably damaging Het
Lifr T A 15: 7,202,418 (GRCm39) I353K probably benign Het
Llph A T 10: 120,067,189 (GRCm39) N102I probably damaging Het
Lmo3 C A 6: 138,393,566 (GRCm39) R18L possibly damaging Het
Lrrc46 T C 11: 96,926,371 (GRCm39) E175G probably benign Het
Ltk A T 2: 119,585,075 (GRCm39) C128* probably null Het
Map1b T C 13: 99,571,275 (GRCm39) E482G probably damaging Het
Mapk8ip2 T C 15: 89,344,655 (GRCm39) V740A probably damaging Het
Miga2 T C 2: 30,261,175 (GRCm39) W157R probably benign Het
Mlip A G 9: 77,009,675 (GRCm39) *837Q probably null Het
Mroh2a G T 1: 88,182,657 (GRCm39) R1195L possibly damaging Het
Myl1 T C 1: 66,984,217 (GRCm39) probably benign Het
Or1l4 T C 2: 37,092,189 (GRCm39) L312P possibly damaging Het
Or2a5 T C 6: 42,873,750 (GRCm39) Y122H probably benign Het
Or51ab3 A G 7: 103,201,075 (GRCm39) I28V probably benign Het
P3h3 A T 6: 124,834,331 (GRCm39) V107D probably benign Het
Papolb A T 5: 142,514,651 (GRCm39) S331T possibly damaging Het
Pars2 T G 4: 106,511,700 (GRCm39) V494G probably benign Het
Pcdhb3 C A 18: 37,434,763 (GRCm39) T243K probably benign Het
Pde9a T A 17: 31,689,698 (GRCm39) M415K probably damaging Het
Ppp1r9b G A 11: 94,882,974 (GRCm39) A201T probably benign Het
Prl A G 13: 27,248,942 (GRCm39) N197S possibly damaging Het
Prl2c1 T A 13: 28,035,724 (GRCm39) M32K probably benign Het
Prrt4 T C 6: 29,170,737 (GRCm39) S572G possibly damaging Het
Psd T A 19: 46,310,858 (GRCm39) D397V probably damaging Het
Psme2b A T 11: 48,836,307 (GRCm39) Y213* probably null Het
Ptcd3 T A 6: 71,874,094 (GRCm39) probably null Het
Ptprk T G 10: 28,210,480 (GRCm39) F167L probably damaging Het
Rfx7 T C 9: 72,524,226 (GRCm39) V472A probably damaging Het
Sanbr A G 11: 23,575,100 (GRCm39) L58P probably damaging Het
Scnn1g T C 7: 121,339,576 (GRCm39) L125S probably damaging Het
Sec16a T C 2: 26,320,124 (GRCm39) Y1438C probably damaging Het
Serinc3 C T 2: 163,476,366 (GRCm39) S155N probably benign Het
Slc3a2 A T 19: 8,690,996 (GRCm39) V78E probably damaging Het
Slc44a4 T A 17: 35,140,044 (GRCm39) L23Q probably damaging Het
Slco5a1 C T 1: 12,951,420 (GRCm39) probably benign Het
Slit1 A G 19: 41,605,154 (GRCm39) M899T probably benign Het
Sorl1 A G 9: 41,933,688 (GRCm39) I1094T probably benign Het
Spag9 T A 11: 93,972,196 (GRCm39) L258Q probably benign Het
Strip1 T C 3: 107,526,252 (GRCm39) E488G possibly damaging Het
Stx18 G A 5: 38,262,235 (GRCm39) D30N possibly damaging Het
Sync T C 4: 129,181,583 (GRCm39) probably null Het
Syncrip A G 9: 88,358,849 (GRCm39) V220A probably damaging Het
Tagln2 T C 1: 172,333,476 (GRCm39) I110T probably benign Het
Taok1 T C 11: 77,432,627 (GRCm39) T729A probably benign Het
Tgfbrap1 C T 1: 43,106,759 (GRCm39) V75I possibly damaging Het
Tnfrsf21 A G 17: 43,327,957 (GRCm39) T24A probably benign Het
Tnxb T A 17: 34,932,131 (GRCm39) D2221E probably damaging Het
Triml1 A G 8: 43,583,603 (GRCm39) S333P probably damaging Het
Trp53bp1 C A 2: 121,029,594 (GRCm39) R1862L probably damaging Het
Tsc22d1 T G 14: 76,655,732 (GRCm39) I737S possibly damaging Het
U2af2 A T 7: 5,082,273 (GRCm39) K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 (GRCm39) N86K probably damaging Het
Uso1 A G 5: 92,343,207 (GRCm39) K764E probably benign Het
Vmn1r192 T A 13: 22,372,122 (GRCm39) M33L probably benign Het
Other mutations in Fbxw22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Fbxw22 APN 9 109,213,108 (GRCm39) missense possibly damaging 0.68
IGL00655:Fbxw22 APN 9 109,211,312 (GRCm39) splice site probably benign
IGL01122:Fbxw22 APN 9 109,215,739 (GRCm39) missense probably damaging 0.99
IGL01419:Fbxw22 APN 9 109,210,790 (GRCm39) missense probably benign 0.03
IGL01455:Fbxw22 APN 9 109,214,062 (GRCm39) missense probably benign
IGL01486:Fbxw22 APN 9 109,207,941 (GRCm39) missense probably damaging 1.00
IGL01734:Fbxw22 APN 9 109,212,993 (GRCm39) missense probably damaging 0.98
IGL02106:Fbxw22 APN 9 109,231,087 (GRCm39) missense possibly damaging 0.86
IGL02255:Fbxw22 APN 9 109,215,619 (GRCm39) splice site probably benign
IGL02466:Fbxw22 APN 9 109,214,160 (GRCm39) missense probably damaging 1.00
IGL02820:Fbxw22 APN 9 109,215,732 (GRCm39) missense probably damaging 1.00
R0395:Fbxw22 UTSW 9 109,210,753 (GRCm39) missense probably damaging 1.00
R0705:Fbxw22 UTSW 9 109,232,164 (GRCm39) missense possibly damaging 0.92
R0741:Fbxw22 UTSW 9 109,211,287 (GRCm39) missense probably benign 0.01
R1603:Fbxw22 UTSW 9 109,207,915 (GRCm39) missense probably benign 0.00
R1673:Fbxw22 UTSW 9 109,211,196 (GRCm39) missense possibly damaging 0.93
R1874:Fbxw22 UTSW 9 109,214,179 (GRCm39) nonsense probably null
R2265:Fbxw22 UTSW 9 109,213,062 (GRCm39) missense probably benign 0.02
R2269:Fbxw22 UTSW 9 109,213,062 (GRCm39) missense probably benign 0.02
R2385:Fbxw22 UTSW 9 109,211,210 (GRCm39) missense probably damaging 1.00
R4329:Fbxw22 UTSW 9 109,213,111 (GRCm39) missense probably damaging 1.00
R4695:Fbxw22 UTSW 9 109,207,939 (GRCm39) missense probably damaging 1.00
R4731:Fbxw22 UTSW 9 109,207,937 (GRCm39) missense probably benign 0.02
R4915:Fbxw22 UTSW 9 109,213,009 (GRCm39) missense probably damaging 1.00
R5010:Fbxw22 UTSW 9 109,232,492 (GRCm39) missense probably benign 0.40
R5070:Fbxw22 UTSW 9 109,214,183 (GRCm39) missense probably benign
R5319:Fbxw22 UTSW 9 109,213,015 (GRCm39) missense possibly damaging 0.52
R5571:Fbxw22 UTSW 9 109,232,156 (GRCm39) missense probably damaging 1.00
R5765:Fbxw22 UTSW 9 109,214,064 (GRCm39) missense probably benign 0.00
R5846:Fbxw22 UTSW 9 109,215,829 (GRCm39) missense probably benign
R6002:Fbxw22 UTSW 9 109,210,750 (GRCm39) nonsense probably null
R6180:Fbxw22 UTSW 9 109,215,747 (GRCm39) missense probably damaging 1.00
R6313:Fbxw22 UTSW 9 109,232,465 (GRCm39) missense probably damaging 0.99
R6949:Fbxw22 UTSW 9 109,211,144 (GRCm39) missense probably benign 0.06
R7084:Fbxw22 UTSW 9 109,233,291 (GRCm39) missense probably damaging 1.00
R7296:Fbxw22 UTSW 9 109,211,143 (GRCm39) missense probably benign
R8499:Fbxw22 UTSW 9 109,214,068 (GRCm39) missense probably benign 0.00
R9088:Fbxw22 UTSW 9 109,207,952 (GRCm39) missense probably damaging 1.00
R9301:Fbxw22 UTSW 9 109,215,653 (GRCm39) missense possibly damaging 0.60
R9501:Fbxw22 UTSW 9 109,207,920 (GRCm39) missense probably benign 0.01
R9600:Fbxw22 UTSW 9 109,212,986 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGACAGCAGCCTCTATG -3'
(R):5'- GAACAGATGCAACCACTCTTG -3'

Sequencing Primer
(F):5'- ATGCAGTTTTCCTGACTCAGAATC -3'
(R):5'- GTGCCAGGCTTCAGATATTTAC -3'
Posted On 2018-09-12