Incidental Mutation 'R6861:Cavin4'
ID 535506
Institutional Source Beutler Lab
Gene Symbol Cavin4
Ensembl Gene ENSMUSG00000028348
Gene Name caveolae associated 4
Synonyms cavin 4, Murc, 2310039E09Rik
MMRRC Submission 044962-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 48663514-48673492 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48672214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 220 (I220V)
Ref Sequence ENSEMBL: ENSMUSP00000030033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030033]
AlphaFold A2AMM0
Predicted Effect probably benign
Transcript: ENSMUST00000030033
AA Change: I220V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030033
Gene: ENSMUSG00000028348
AA Change: I220V

DomainStartEndE-ValueType
Pfam:PTRF_SDPR 27 263 7.8e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with normal cardiac mass and function under physiological conditions. Phenylephrine-induced cardiac hypertrophy is suppressed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 G A 3: 95,588,194 (GRCm39) R598C probably damaging Het
Adra2a T C 19: 54,034,818 (GRCm39) L58P probably damaging Het
Ajm1 C CTCTA 2: 25,469,733 (GRCm39) probably null Het
Alox5ap A G 5: 149,201,927 (GRCm39) D2G probably damaging Het
Arid1b G A 17: 5,377,961 (GRCm39) V1238M possibly damaging Het
Bank1 A G 3: 135,960,764 (GRCm39) V31A probably benign Het
Bptf G A 11: 106,953,391 (GRCm39) T2117M probably damaging Het
Cadps G A 14: 12,522,401 (GRCm38) R588* probably null Het
Cep192 G A 18: 67,974,699 (GRCm39) M1267I probably benign Het
Cers5 G A 15: 99,670,244 (GRCm39) probably benign Het
Cfap65 A T 1: 74,964,274 (GRCm39) I558N probably damaging Het
Cfh A T 1: 140,028,621 (GRCm39) S1025T probably benign Het
Cftr A G 6: 18,268,107 (GRCm39) I689V probably benign Het
Cgrrf1 T C 14: 47,069,785 (GRCm39) I18T probably damaging Het
CK137956 A G 4: 127,864,519 (GRCm39) S37P probably damaging Het
Clca4a T C 3: 144,676,416 (GRCm39) D88G probably benign Het
Col11a1 G A 3: 113,961,141 (GRCm39) G1166D probably damaging Het
Col24a1 G A 3: 145,166,589 (GRCm39) G1075S probably damaging Het
Crispld2 C T 8: 120,752,852 (GRCm39) T299M probably damaging Het
Cyb561a3 T A 19: 10,562,701 (GRCm39) Y114N probably damaging Het
Cyp3a57 T A 5: 145,307,773 (GRCm39) W147R possibly damaging Het
Dnah2 C A 11: 69,346,789 (GRCm39) R2599L possibly damaging Het
Dock1 T A 7: 134,373,207 (GRCm39) S525T probably benign Het
Drc7 T G 8: 95,789,025 (GRCm39) probably null Het
Efhd2 G T 4: 141,587,192 (GRCm39) probably null Het
Epb41l1 A T 2: 156,367,142 (GRCm39) E658D probably benign Het
Evi5 C T 5: 107,896,184 (GRCm39) S753N probably benign Het
Exoc3 A T 13: 74,337,319 (GRCm39) D427E probably benign Het
Fbxw9 A G 8: 85,792,740 (GRCm39) D363G probably damaging Het
Fcer2a T C 8: 3,732,910 (GRCm39) Y277C probably damaging Het
Fstl5 A T 3: 76,229,523 (GRCm39) Y108F probably damaging Het
Gcn1 A G 5: 115,749,108 (GRCm39) D1880G probably benign Het
Gm4924 T A 10: 82,214,948 (GRCm39) Y915* probably null Het
Gpr139 T A 7: 118,743,875 (GRCm39) I237F probably benign Het
Hao2 A G 3: 98,784,498 (GRCm39) L289S probably damaging Het
Hexim1 A G 11: 103,007,793 (GRCm39) S16G probably benign Het
Hmgcs1 T A 13: 120,161,535 (GRCm39) M109K probably damaging Het
Hs3st4 T A 7: 123,996,052 (GRCm39) N239K possibly damaging Het
Hsd3b5 T A 3: 98,529,328 (GRCm39) N101Y probably damaging Het
Idh2 G A 7: 79,747,966 (GRCm39) P245S probably damaging Het
Irx3 A G 8: 92,525,530 (GRCm39) probably benign Het
Lilra5 A T 7: 4,244,931 (GRCm39) D234V probably benign Het
Lrfn5 G A 12: 61,886,476 (GRCm39) S88N probably damaging Het
Lrp2 A T 2: 69,343,721 (GRCm39) S879R possibly damaging Het
Lsm11 A G 11: 45,824,781 (GRCm39) S249P probably benign Het
Ltbp1 C T 17: 75,534,187 (GRCm39) A543V possibly damaging Het
Mbd1 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,406,645 (GRCm39) Het
Mier2 C T 10: 79,376,990 (GRCm39) probably benign Het
Mup6 G C 4: 60,004,093 (GRCm39) G70A probably benign Het
Neb A G 2: 52,085,732 (GRCm39) L5258P probably damaging Het
Nlrc5 G A 8: 95,247,857 (GRCm39) probably benign Het
Nr6a1 A T 2: 38,630,597 (GRCm39) F207I possibly damaging Het
Or2y1 A T 11: 49,385,632 (GRCm39) T91S probably benign Het
Or5k17 A T 16: 58,746,867 (GRCm39) D22E probably benign Het
Or8b43 T C 9: 38,360,731 (GRCm39) C188R probably damaging Het
Osbp2 A G 11: 3,665,191 (GRCm39) V51A possibly damaging Het
Papln G T 12: 83,821,723 (GRCm39) C317F probably damaging Het
Pdcd7 T C 9: 65,265,904 (GRCm39) S454P probably damaging Het
Pde4a C T 9: 21,116,597 (GRCm39) T473I probably damaging Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 (GRCm39) probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 (GRCm39) probably benign Het
Peg3 G T 7: 6,714,385 (GRCm39) S279* probably null Het
Rbl1 A G 2: 156,994,887 (GRCm39) Y929H probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,229,116 (GRCm39) probably benign Het
Sall3 C A 18: 81,017,590 (GRCm39) E113* probably null Het
Scn5a A C 9: 119,359,089 (GRCm39) F653V probably damaging Het
Selenok T A 14: 29,692,005 (GRCm39) N14K possibly damaging Het
Slc22a20 T C 19: 6,021,838 (GRCm39) T426A probably benign Het
Slc4a2 T A 5: 24,640,007 (GRCm39) S563T probably damaging Het
Sspo T A 6: 48,464,889 (GRCm39) S3798T probably benign Het
Stag3 G T 5: 138,302,969 (GRCm39) R63L possibly damaging Het
Stard9 A T 2: 120,535,667 (GRCm39) M3975L probably benign Het
Syne2 C A 12: 75,956,040 (GRCm39) T582K probably damaging Het
Synj1 G A 16: 90,760,768 (GRCm39) Q748* probably null Het
Tas2r109 T C 6: 132,957,048 (GRCm39) D294G probably benign Het
Tbl1xr1 C T 3: 22,245,603 (GRCm39) T203M possibly damaging Het
Tbl1xr1 T A 3: 22,245,703 (GRCm39) probably null Het
Tcf7l2 A G 19: 55,730,955 (GRCm39) D19G probably damaging Het
Tecta A G 9: 42,248,633 (GRCm39) V1923A possibly damaging Het
Tg T A 15: 66,560,740 (GRCm39) M1034K probably benign Het
Ttf2 T C 3: 100,876,941 (GRCm39) E8G possibly damaging Het
Vps13b T A 15: 35,576,541 (GRCm39) V983E probably damaging Het
Vps35l A G 7: 118,342,898 (GRCm39) H32R probably damaging Het
Vwa2 T C 19: 56,890,025 (GRCm39) V210A probably benign Het
Xkr6 T A 14: 64,057,093 (GRCm39) Y335N probably benign Het
Zfp97 A G 17: 17,365,437 (GRCm39) H312R probably damaging Het
Other mutations in Cavin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1127:Cavin4 UTSW 4 48,663,637 (GRCm39) missense probably damaging 1.00
R1298:Cavin4 UTSW 4 48,672,593 (GRCm39) missense probably benign 0.02
R5389:Cavin4 UTSW 4 48,663,907 (GRCm39) missense probably damaging 1.00
R5668:Cavin4 UTSW 4 48,672,499 (GRCm39) missense probably benign
R5827:Cavin4 UTSW 4 48,672,074 (GRCm39) missense probably damaging 1.00
R6145:Cavin4 UTSW 4 48,663,794 (GRCm39) missense probably damaging 1.00
R6180:Cavin4 UTSW 4 48,663,917 (GRCm39) missense possibly damaging 0.95
R6334:Cavin4 UTSW 4 48,663,824 (GRCm39) missense possibly damaging 0.77
R7038:Cavin4 UTSW 4 48,672,479 (GRCm39) missense probably benign 0.25
R7378:Cavin4 UTSW 4 48,663,631 (GRCm39) missense probably benign 0.24
R7718:Cavin4 UTSW 4 48,671,984 (GRCm39) missense probably benign 0.14
R8909:Cavin4 UTSW 4 48,672,421 (GRCm39) missense probably benign 0.25
R9548:Cavin4 UTSW 4 48,663,956 (GRCm39) missense probably benign 0.00
R9603:Cavin4 UTSW 4 48,671,999 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CGCATCCCTGTCTGTTGTTAAAG -3'
(R):5'- CGCTTTCCTAAGGCTCCGAATC -3'

Sequencing Primer
(F):5'- CTGTTGTTAAAGACAGAAGCCTGCC -3'
(R):5'- GGCTCCGAATCTTAAAAGCTTC -3'
Posted On 2018-09-12