Incidental Mutation 'R6861:Lilra5'
ID535521
Institutional Source Beutler Lab
Gene Symbol Lilra5
Ensembl Gene ENSMUSG00000070873
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
SynonymsGm4878
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6861 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4237754-4243463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4241932 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 234 (D234V)
Ref Sequence ENSEMBL: ENSMUSP00000113091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117550]
Predicted Effect probably benign
Transcript: ENSMUST00000117550
AA Change: D234V

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113091
Gene: ENSMUSG00000070873
AA Change: D234V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 34 118 4.67e-4 SMART
IG_like 129 217 5.13e0 SMART
transmembrane domain 250 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,743,675 H32R probably damaging Het
Adamtsl4 G A 3: 95,680,884 R598C probably damaging Het
Adra2a T C 19: 54,046,387 L58P probably damaging Het
Alox5ap A G 5: 149,265,117 D2G probably damaging Het
Arid1b G A 17: 5,327,686 V1238M possibly damaging Het
Bank1 A G 3: 136,255,003 V31A probably benign Het
Bptf G A 11: 107,062,565 T2117M probably damaging Het
Cadps G A 14: 12,522,401 R588* probably null Het
Cavin4 A G 4: 48,672,214 I220V probably benign Het
Cep192 G A 18: 67,841,628 M1267I probably benign Het
Cers5 G A 15: 99,772,363 probably benign Het
Cfap65 A T 1: 74,925,115 I558N probably damaging Het
Cfh A T 1: 140,100,883 S1025T probably benign Het
Cftr A G 6: 18,268,108 I689V probably benign Het
Cgrrf1 T C 14: 46,832,328 I18T probably damaging Het
CK137956 A G 4: 127,970,726 S37P probably damaging Het
Clca4a T C 3: 144,970,655 D88G probably benign Het
Col11a1 G A 3: 114,167,492 G1166D probably damaging Het
Col24a1 G A 3: 145,460,834 G1075S probably damaging Het
Crispld2 C T 8: 120,026,113 T299M probably damaging Het
Cyb561a3 T A 19: 10,585,337 Y114N probably damaging Het
Cyp3a57 T A 5: 145,370,963 W147R possibly damaging Het
Dnah2 C A 11: 69,455,963 R2599L possibly damaging Het
Dock1 T A 7: 134,771,478 S525T probably benign Het
Drc7 T G 8: 95,062,397 probably null Het
Efhd2 G T 4: 141,859,881 probably null Het
Epb41l1 A T 2: 156,525,222 E658D probably benign Het
Evi5 C T 5: 107,748,318 S753N probably benign Het
Exoc3 A T 13: 74,189,200 D427E probably benign Het
Fbxw9 A G 8: 85,066,111 D363G probably damaging Het
Fcer2a T C 8: 3,682,910 Y277C probably damaging Het
Fstl5 A T 3: 76,322,216 Y108F probably damaging Het
Gcn1l1 A G 5: 115,611,049 D1880G probably benign Het
Gm4924 T A 10: 82,379,114 Y915* probably null Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Gpr139 T A 7: 119,144,652 I237F probably benign Het
Hao2 A G 3: 98,877,182 L289S probably damaging Het
Hexim1 A G 11: 103,116,967 S16G probably benign Het
Hmgcs1 T A 13: 119,699,999 M109K probably damaging Het
Hs3st4 T A 7: 124,396,829 N239K possibly damaging Het
Hsd3b5 T A 3: 98,622,012 N101Y probably damaging Het
Idh2 G A 7: 80,098,218 P245S probably damaging Het
Irx3 A G 8: 91,798,902 probably benign Het
Lrfn5 G A 12: 61,839,690 S88N probably damaging Het
Lrp2 A T 2: 69,513,377 S879R possibly damaging Het
Lsm11 A G 11: 45,933,954 S249P probably benign Het
Ltbp1 C T 17: 75,227,192 A543V possibly damaging Het
Mbd1 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,574 Het
Mier2 C T 10: 79,541,156 probably benign Het
Mup6 G C 4: 60,004,093 G70A probably benign Het
Neb A G 2: 52,195,720 L5258P probably damaging Het
Nlrc5 G A 8: 94,521,229 probably benign Het
Nr6a1 A T 2: 38,740,585 F207I possibly damaging Het
Olfr1385 A T 11: 49,494,805 T91S probably benign Het
Olfr181 A T 16: 58,926,504 D22E probably benign Het
Olfr902 T C 9: 38,449,435 C188R probably damaging Het
Osbp2 A G 11: 3,715,191 V51A possibly damaging Het
Papln G T 12: 83,774,949 C317F probably damaging Het
Pdcd7 T C 9: 65,358,622 S454P probably damaging Het
Pde4a C T 9: 21,205,301 T473I probably damaging Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Peg3 G T 7: 6,711,386 S279* probably null Het
Rbl1 A G 2: 157,152,967 Y929H probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall3 C A 18: 80,974,375 E113* probably null Het
Scn5a A C 9: 119,530,023 F653V probably damaging Het
Selenok T A 14: 29,970,048 N14K possibly damaging Het
Slc22a20 T C 19: 5,971,810 T426A probably benign Het
Slc4a2 T A 5: 24,435,009 S563T probably damaging Het
Sspo T A 6: 48,487,955 S3798T probably benign Het
Stag3 G T 5: 138,304,707 R63L possibly damaging Het
Stard9 A T 2: 120,705,186 M3975L probably benign Het
Syne2 C A 12: 75,909,266 T582K probably damaging Het
Synj1 G A 16: 90,963,880 Q748* probably null Het
Tas2r109 T C 6: 132,980,085 D294G probably benign Het
Tbl1xr1 T A 3: 22,191,539 probably null Het
Tbl1xr1 C T 3: 22,191,439 T203M possibly damaging Het
Tcf7l2 A G 19: 55,742,523 D19G probably damaging Het
Tecta A G 9: 42,337,337 V1923A possibly damaging Het
Tg T A 15: 66,688,891 M1034K probably benign Het
Ttf2 T C 3: 100,969,625 E8G possibly damaging Het
Vps13b T A 15: 35,576,395 V983E probably damaging Het
Vwa2 T C 19: 56,901,593 V210A probably benign Het
Xkr6 T A 14: 63,819,644 Y335N probably benign Het
Zfp97 A G 17: 17,145,175 H312R probably damaging Het
Other mutations in Lilra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Lilra5 APN 7 4237969 missense probably benign
IGL02281:Lilra5 APN 7 4238783 missense probably benign 0.00
R0458:Lilra5 UTSW 7 4238219 missense probably benign 0.26
R0611:Lilra5 UTSW 7 4242233 missense probably benign
R0685:Lilra5 UTSW 7 4241957 splice site probably benign
R3195:Lilra5 UTSW 7 4238757 missense probably damaging 0.96
R4726:Lilra5 UTSW 7 4237958 missense probably benign 0.00
R4745:Lilra5 UTSW 7 4242077 missense possibly damaging 0.72
R4836:Lilra5 UTSW 7 4238714 missense possibly damaging 0.71
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6263:Lilra5 UTSW 7 4238361 missense probably damaging 1.00
R6266:Lilra5 UTSW 7 4241928 missense possibly damaging 0.84
R6285:Lilra5 UTSW 7 4242115 missense probably damaging 1.00
R6292:Lilra5 UTSW 7 4238339 missense possibly damaging 0.81
R6344:Lilra5 UTSW 7 4238786 missense probably damaging 1.00
R8353:Lilra5 UTSW 7 4237972 missense probably benign 0.06
R8681:Lilra5 UTSW 7 4238217 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATGGGCTTCTACACCTGACTAG -3'
(R):5'- ATCCTGATGAGGTTCTCCATTG -3'

Sequencing Primer
(F):5'- ACCCCCTCTTTAAATGTCATTTATG -3'
(R):5'- CTCCATTGTGTAATTCTGGGGC -3'
Posted On2018-09-12