Incidental Mutation 'R6861:Fcer2a'
ID535529
Institutional Source Beutler Lab
Gene Symbol Fcer2a
Ensembl Gene ENSMUSG00000005540
Gene NameFc receptor, IgE, low affinity II, alpha polypeptide
SynonymsLy-42, FC epsilon RII, CD23, Fce2, low-affinity IgE receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6861 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3681737-3694175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3682910 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 277 (Y277C)
Ref Sequence ENSEMBL: ENSMUSP00000146822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005678] [ENSMUST00000044857] [ENSMUST00000207463] [ENSMUST00000207635] [ENSMUST00000207787] [ENSMUST00000208145] [ENSMUST00000208438] [ENSMUST00000208492] [ENSMUST00000208603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005678
AA Change: Y299C

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005678
Gene: ENSMUSG00000005540
AA Change: Y299C

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
coiled coil region 80 150 N/A INTRINSIC
CLECT 186 306 2.11e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044857
SMART Domains Protein: ENSMUSP00000036541
Gene: ENSMUSG00000040236

DomainStartEndE-ValueType
Pfam:TRAPP 28 177 3.2e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207463
AA Change: Y259C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207635
AA Change: Y272C

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000207787
Predicted Effect probably damaging
Transcript: ENSMUST00000208145
AA Change: Y298C

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000208438
AA Change: Y277C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208492
AA Change: Y298C

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208603
AA Change: Y277C

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for mutations in this gene are essentially normal although IgE levels or IgE mediated responses may be abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,743,675 H32R probably damaging Het
Adamtsl4 G A 3: 95,680,884 R598C probably damaging Het
Adra2a T C 19: 54,046,387 L58P probably damaging Het
Alox5ap A G 5: 149,265,117 D2G probably damaging Het
Arid1b G A 17: 5,327,686 V1238M possibly damaging Het
Bank1 A G 3: 136,255,003 V31A probably benign Het
Bptf G A 11: 107,062,565 T2117M probably damaging Het
Cadps G A 14: 12,522,401 R588* probably null Het
Cavin4 A G 4: 48,672,214 I220V probably benign Het
Cep192 G A 18: 67,841,628 M1267I probably benign Het
Cers5 G A 15: 99,772,363 probably benign Het
Cfap65 A T 1: 74,925,115 I558N probably damaging Het
Cfh A T 1: 140,100,883 S1025T probably benign Het
Cftr A G 6: 18,268,108 I689V probably benign Het
Cgrrf1 T C 14: 46,832,328 I18T probably damaging Het
CK137956 A G 4: 127,970,726 S37P probably damaging Het
Clca4a T C 3: 144,970,655 D88G probably benign Het
Col11a1 G A 3: 114,167,492 G1166D probably damaging Het
Col24a1 G A 3: 145,460,834 G1075S probably damaging Het
Crispld2 C T 8: 120,026,113 T299M probably damaging Het
Cyb561a3 T A 19: 10,585,337 Y114N probably damaging Het
Cyp3a57 T A 5: 145,370,963 W147R possibly damaging Het
Dnah2 C A 11: 69,455,963 R2599L possibly damaging Het
Dock1 T A 7: 134,771,478 S525T probably benign Het
Drc7 T G 8: 95,062,397 probably null Het
Efhd2 G T 4: 141,859,881 probably null Het
Epb41l1 A T 2: 156,525,222 E658D probably benign Het
Evi5 C T 5: 107,748,318 S753N probably benign Het
Exoc3 A T 13: 74,189,200 D427E probably benign Het
Fbxw9 A G 8: 85,066,111 D363G probably damaging Het
Fstl5 A T 3: 76,322,216 Y108F probably damaging Het
Gcn1l1 A G 5: 115,611,049 D1880G probably benign Het
Gm4924 T A 10: 82,379,114 Y915* probably null Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Gpr139 T A 7: 119,144,652 I237F probably benign Het
Hao2 A G 3: 98,877,182 L289S probably damaging Het
Hexim1 A G 11: 103,116,967 S16G probably benign Het
Hmgcs1 T A 13: 119,699,999 M109K probably damaging Het
Hs3st4 T A 7: 124,396,829 N239K possibly damaging Het
Hsd3b5 T A 3: 98,622,012 N101Y probably damaging Het
Idh2 G A 7: 80,098,218 P245S probably damaging Het
Irx3 A G 8: 91,798,902 probably benign Het
Lilra5 A T 7: 4,241,932 D234V probably benign Het
Lrfn5 G A 12: 61,839,690 S88N probably damaging Het
Lrp2 A T 2: 69,513,377 S879R possibly damaging Het
Lsm11 A G 11: 45,933,954 S249P probably benign Het
Ltbp1 C T 17: 75,227,192 A543V possibly damaging Het
Mbd1 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,574 Het
Mier2 C T 10: 79,541,156 probably benign Het
Mup6 G C 4: 60,004,093 G70A probably benign Het
Neb A G 2: 52,195,720 L5258P probably damaging Het
Nlrc5 G A 8: 94,521,229 probably benign Het
Nr6a1 A T 2: 38,740,585 F207I possibly damaging Het
Olfr1385 A T 11: 49,494,805 T91S probably benign Het
Olfr181 A T 16: 58,926,504 D22E probably benign Het
Olfr902 T C 9: 38,449,435 C188R probably damaging Het
Osbp2 A G 11: 3,715,191 V51A possibly damaging Het
Papln G T 12: 83,774,949 C317F probably damaging Het
Pdcd7 T C 9: 65,358,622 S454P probably damaging Het
Pde4a C T 9: 21,205,301 T473I probably damaging Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Peg3 G T 7: 6,711,386 S279* probably null Het
Rbl1 A G 2: 157,152,967 Y929H probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall3 C A 18: 80,974,375 E113* probably null Het
Scn5a A C 9: 119,530,023 F653V probably damaging Het
Selenok T A 14: 29,970,048 N14K possibly damaging Het
Slc22a20 T C 19: 5,971,810 T426A probably benign Het
Slc4a2 T A 5: 24,435,009 S563T probably damaging Het
Sspo T A 6: 48,487,955 S3798T probably benign Het
Stag3 G T 5: 138,304,707 R63L possibly damaging Het
Stard9 A T 2: 120,705,186 M3975L probably benign Het
Syne2 C A 12: 75,909,266 T582K probably damaging Het
Synj1 G A 16: 90,963,880 Q748* probably null Het
Tas2r109 T C 6: 132,980,085 D294G probably benign Het
Tbl1xr1 C T 3: 22,191,439 T203M possibly damaging Het
Tbl1xr1 T A 3: 22,191,539 probably null Het
Tcf7l2 A G 19: 55,742,523 D19G probably damaging Het
Tecta A G 9: 42,337,337 V1923A possibly damaging Het
Tg T A 15: 66,688,891 M1034K probably benign Het
Ttf2 T C 3: 100,969,625 E8G possibly damaging Het
Vps13b T A 15: 35,576,395 V983E probably damaging Het
Vwa2 T C 19: 56,901,593 V210A probably benign Het
Xkr6 T A 14: 63,819,644 Y335N probably benign Het
Zfp97 A G 17: 17,145,175 H312R probably damaging Het
Other mutations in Fcer2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Fcer2a APN 8 3688842 missense possibly damaging 0.94
IGL01458:Fcer2a APN 8 3688151 missense probably benign 0.45
IGL01545:Fcer2a APN 8 3683598 nonsense probably null
IGL01994:Fcer2a APN 8 3688302 missense possibly damaging 0.94
IGL03340:Fcer2a APN 8 3688310 missense possibly damaging 0.75
anemone UTSW 8 3688796 critical splice donor site probably null
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0276:Fcer2a UTSW 8 3689811 missense possibly damaging 0.89
R1530:Fcer2a UTSW 8 3682976 missense probably damaging 0.98
R2202:Fcer2a UTSW 8 3688557 missense possibly damaging 0.72
R4133:Fcer2a UTSW 8 3691130 missense possibly damaging 0.60
R4249:Fcer2a UTSW 8 3688831 missense probably benign 0.00
R4273:Fcer2a UTSW 8 3682848 missense possibly damaging 0.81
R4506:Fcer2a UTSW 8 3688603 splice site probably null
R6796:Fcer2a UTSW 8 3689830 missense possibly damaging 0.92
R7421:Fcer2a UTSW 8 3690335 missense probably benign
R7795:Fcer2a UTSW 8 3682910 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCCTTCGGTCACAGAG -3'
(R):5'- ATCCCCAAAGGTGCAATCGG -3'

Sequencing Primer
(F):5'- CCTGATAGGGGTATCCTCAGG -3'
(R):5'- TCGGTGCTATGGAAGGAGGC -3'
Posted On2018-09-12