Incidental Mutation 'R6861:Papln'
ID535550
Institutional Source Beutler Lab
Gene Symbol Papln
Ensembl Gene ENSMUSG00000021223
Gene Namepapilin, proteoglycan-like sulfated glycoprotein
SynonymsE030033C16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6861 (G1)
Quality Score206.009
Status Not validated
Chromosome12
Chromosomal Location83763634-83792382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83774949 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 317 (C317F)
Ref Sequence ENSEMBL: ENSMUSP00000113806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]
Predicted Effect probably damaging
Transcript: ENSMUST00000021646
AA Change: C317F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: C317F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121733
AA Change: C317F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: C317F

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,743,675 H32R probably damaging Het
Adamtsl4 G A 3: 95,680,884 R598C probably damaging Het
Adra2a T C 19: 54,046,387 L58P probably damaging Het
Alox5ap A G 5: 149,265,117 D2G probably damaging Het
Arid1b G A 17: 5,327,686 V1238M possibly damaging Het
Bank1 A G 3: 136,255,003 V31A probably benign Het
Bptf G A 11: 107,062,565 T2117M probably damaging Het
Cadps G A 14: 12,522,401 R588* probably null Het
Cavin4 A G 4: 48,672,214 I220V probably benign Het
Cep192 G A 18: 67,841,628 M1267I probably benign Het
Cers5 G A 15: 99,772,363 probably benign Het
Cfap65 A T 1: 74,925,115 I558N probably damaging Het
Cfh A T 1: 140,100,883 S1025T probably benign Het
Cftr A G 6: 18,268,108 I689V probably benign Het
Cgrrf1 T C 14: 46,832,328 I18T probably damaging Het
CK137956 A G 4: 127,970,726 S37P probably damaging Het
Clca4a T C 3: 144,970,655 D88G probably benign Het
Col11a1 G A 3: 114,167,492 G1166D probably damaging Het
Col24a1 G A 3: 145,460,834 G1075S probably damaging Het
Crispld2 C T 8: 120,026,113 T299M probably damaging Het
Cyb561a3 T A 19: 10,585,337 Y114N probably damaging Het
Cyp3a57 T A 5: 145,370,963 W147R possibly damaging Het
Dnah2 C A 11: 69,455,963 R2599L possibly damaging Het
Dock1 T A 7: 134,771,478 S525T probably benign Het
Drc7 T G 8: 95,062,397 probably null Het
Efhd2 G T 4: 141,859,881 probably null Het
Epb41l1 A T 2: 156,525,222 E658D probably benign Het
Evi5 C T 5: 107,748,318 S753N probably benign Het
Exoc3 A T 13: 74,189,200 D427E probably benign Het
Fbxw9 A G 8: 85,066,111 D363G probably damaging Het
Fcer2a T C 8: 3,682,910 Y277C probably damaging Het
Fstl5 A T 3: 76,322,216 Y108F probably damaging Het
Gcn1l1 A G 5: 115,611,049 D1880G probably benign Het
Gm4924 T A 10: 82,379,114 Y915* probably null Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Gpr139 T A 7: 119,144,652 I237F probably benign Het
Hao2 A G 3: 98,877,182 L289S probably damaging Het
Hexim1 A G 11: 103,116,967 S16G probably benign Het
Hmgcs1 T A 13: 119,699,999 M109K probably damaging Het
Hs3st4 T A 7: 124,396,829 N239K possibly damaging Het
Hsd3b5 T A 3: 98,622,012 N101Y probably damaging Het
Idh2 G A 7: 80,098,218 P245S probably damaging Het
Irx3 A G 8: 91,798,902 probably benign Het
Lilra5 A T 7: 4,241,932 D234V probably benign Het
Lrfn5 G A 12: 61,839,690 S88N probably damaging Het
Lrp2 A T 2: 69,513,377 S879R possibly damaging Het
Lsm11 A G 11: 45,933,954 S249P probably benign Het
Ltbp1 C T 17: 75,227,192 A543V possibly damaging Het
Mbd1 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,574 Het
Mier2 C T 10: 79,541,156 probably benign Het
Mup6 G C 4: 60,004,093 G70A probably benign Het
Neb A G 2: 52,195,720 L5258P probably damaging Het
Nlrc5 G A 8: 94,521,229 probably benign Het
Nr6a1 A T 2: 38,740,585 F207I possibly damaging Het
Olfr1385 A T 11: 49,494,805 T91S probably benign Het
Olfr181 A T 16: 58,926,504 D22E probably benign Het
Olfr902 T C 9: 38,449,435 C188R probably damaging Het
Osbp2 A G 11: 3,715,191 V51A possibly damaging Het
Pdcd7 T C 9: 65,358,622 S454P probably damaging Het
Pde4a C T 9: 21,205,301 T473I probably damaging Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Peg3 G T 7: 6,711,386 S279* probably null Het
Rbl1 A G 2: 157,152,967 Y929H probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall3 C A 18: 80,974,375 E113* probably null Het
Scn5a A C 9: 119,530,023 F653V probably damaging Het
Selenok T A 14: 29,970,048 N14K possibly damaging Het
Slc22a20 T C 19: 5,971,810 T426A probably benign Het
Slc4a2 T A 5: 24,435,009 S563T probably damaging Het
Sspo T A 6: 48,487,955 S3798T probably benign Het
Stag3 G T 5: 138,304,707 R63L possibly damaging Het
Stard9 A T 2: 120,705,186 M3975L probably benign Het
Syne2 C A 12: 75,909,266 T582K probably damaging Het
Synj1 G A 16: 90,963,880 Q748* probably null Het
Tas2r109 T C 6: 132,980,085 D294G probably benign Het
Tbl1xr1 C T 3: 22,191,439 T203M possibly damaging Het
Tbl1xr1 T A 3: 22,191,539 probably null Het
Tcf7l2 A G 19: 55,742,523 D19G probably damaging Het
Tecta A G 9: 42,337,337 V1923A possibly damaging Het
Tg T A 15: 66,688,891 M1034K probably benign Het
Ttf2 T C 3: 100,969,625 E8G possibly damaging Het
Vps13b T A 15: 35,576,395 V983E probably damaging Het
Vwa2 T C 19: 56,901,593 V210A probably benign Het
Xkr6 T A 14: 63,819,644 Y335N probably benign Het
Zfp97 A G 17: 17,145,175 H312R probably damaging Het
Other mutations in Papln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Papln APN 12 83770436 missense possibly damaging 0.81
IGL01788:Papln APN 12 83775462 missense probably benign 0.32
IGL01889:Papln APN 12 83786835 missense probably benign 0.25
IGL02499:Papln APN 12 83780671 missense probably benign 0.00
IGL02567:Papln APN 12 83778837 missense probably benign 0.00
IGL03150:Papln APN 12 83782984 missense probably damaging 1.00
IGL03331:Papln APN 12 83783661 missense probably benign
F5770:Papln UTSW 12 83778834 missense possibly damaging 0.72
R0201:Papln UTSW 12 83783027 splice site probably benign
R0389:Papln UTSW 12 83783379 nonsense probably null
R0763:Papln UTSW 12 83791865 missense possibly damaging 0.54
R1508:Papln UTSW 12 83782916 missense probably damaging 0.99
R1628:Papln UTSW 12 83784406 splice site probably benign
R1920:Papln UTSW 12 83789254 nonsense probably null
R1974:Papln UTSW 12 83782037 missense probably damaging 0.98
R2004:Papln UTSW 12 83773218 missense probably damaging 1.00
R2105:Papln UTSW 12 83780236 missense probably benign 0.04
R2876:Papln UTSW 12 83778927 missense probably damaging 0.96
R4199:Papln UTSW 12 83783392 missense probably null 0.01
R4702:Papln UTSW 12 83781983 missense probably benign 0.01
R4705:Papln UTSW 12 83777208 splice site probably null
R4835:Papln UTSW 12 83774420 missense probably damaging 0.99
R4874:Papln UTSW 12 83777143 missense probably benign 0.01
R4938:Papln UTSW 12 83782903 missense probably benign 0.35
R5000:Papln UTSW 12 83774889 missense probably damaging 1.00
R5149:Papln UTSW 12 83771882 splice site probably null
R5324:Papln UTSW 12 83774571 missense probably damaging 1.00
R5784:Papln UTSW 12 83781980 missense probably benign
R5881:Papln UTSW 12 83771878 missense probably null 0.91
R5977:Papln UTSW 12 83784369 nonsense probably null
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6291:Papln UTSW 12 83783015 missense probably benign 0.01
R6461:Papln UTSW 12 83781813 splice site probably null
R6536:Papln UTSW 12 83781887 missense probably damaging 1.00
R6898:Papln UTSW 12 83777460 missense probably benign 0.03
R6953:Papln UTSW 12 83781885 nonsense probably null
R7155:Papln UTSW 12 83776521 missense probably damaging 1.00
R7450:Papln UTSW 12 83780171 missense probably benign 0.13
R7510:Papln UTSW 12 83772173 missense probably damaging 0.99
V7580:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7581:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7582:Papln UTSW 12 83778834 missense possibly damaging 0.72
Z1088:Papln UTSW 12 83776376 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCACAGTCCTACAGTACGAACG -3'
(R):5'- ATCGTCATGAGCTCCACTCC -3'

Sequencing Primer
(F):5'- TCCTACAGTACGAACGGGGTG -3'
(R):5'- CTTCAGGACAGGGAACTT -3'
Posted On2018-09-12