Incidental Mutation 'R6861:Cep192'
ID 535565
Institutional Source Beutler Lab
Gene Symbol Cep192
Ensembl Gene ENSMUSG00000024542
Gene Name centrosomal protein 192
Synonyms 4631422C13Rik, D430014P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67800107-67885170 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67841628 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1267 (M1267I)
Ref Sequence ENSEMBL: ENSMUSP00000025425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025425]
AlphaFold E9Q4Y4
Predicted Effect probably benign
Transcript: ENSMUST00000025425
AA Change: M1267I

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542
AA Change: M1267I

DomainStartEndE-ValueType
low complexity region 70 84 N/A INTRINSIC
low complexity region 195 217 N/A INTRINSIC
low complexity region 975 991 N/A INTRINSIC
low complexity region 1189 1204 N/A INTRINSIC
low complexity region 2051 2069 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,743,675 H32R probably damaging Het
Adamtsl4 G A 3: 95,680,884 R598C probably damaging Het
Adra2a T C 19: 54,046,387 L58P probably damaging Het
Alox5ap A G 5: 149,265,117 D2G probably damaging Het
Arid1b G A 17: 5,327,686 V1238M possibly damaging Het
Bank1 A G 3: 136,255,003 V31A probably benign Het
Bptf G A 11: 107,062,565 T2117M probably damaging Het
Cadps G A 14: 12,522,401 R588* probably null Het
Cavin4 A G 4: 48,672,214 I220V probably benign Het
Cers5 G A 15: 99,772,363 probably benign Het
Cfap65 A T 1: 74,925,115 I558N probably damaging Het
Cfh A T 1: 140,100,883 S1025T probably benign Het
Cftr A G 6: 18,268,108 I689V probably benign Het
Cgrrf1 T C 14: 46,832,328 I18T probably damaging Het
CK137956 A G 4: 127,970,726 S37P probably damaging Het
Clca4a T C 3: 144,970,655 D88G probably benign Het
Col11a1 G A 3: 114,167,492 G1166D probably damaging Het
Col24a1 G A 3: 145,460,834 G1075S probably damaging Het
Crispld2 C T 8: 120,026,113 T299M probably damaging Het
Cyb561a3 T A 19: 10,585,337 Y114N probably damaging Het
Cyp3a57 T A 5: 145,370,963 W147R possibly damaging Het
Dnah2 C A 11: 69,455,963 R2599L possibly damaging Het
Dock1 T A 7: 134,771,478 S525T probably benign Het
Drc7 T G 8: 95,062,397 probably null Het
Efhd2 G T 4: 141,859,881 probably null Het
Epb41l1 A T 2: 156,525,222 E658D probably benign Het
Evi5 C T 5: 107,748,318 S753N probably benign Het
Exoc3 A T 13: 74,189,200 D427E probably benign Het
Fbxw9 A G 8: 85,066,111 D363G probably damaging Het
Fcer2a T C 8: 3,682,910 Y277C probably damaging Het
Fstl5 A T 3: 76,322,216 Y108F probably damaging Het
Gcn1l1 A G 5: 115,611,049 D1880G probably benign Het
Gm4924 T A 10: 82,379,114 Y915* probably null Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Gpr139 T A 7: 119,144,652 I237F probably benign Het
Hao2 A G 3: 98,877,182 L289S probably damaging Het
Hexim1 A G 11: 103,116,967 S16G probably benign Het
Hmgcs1 T A 13: 119,699,999 M109K probably damaging Het
Hs3st4 T A 7: 124,396,829 N239K possibly damaging Het
Hsd3b5 T A 3: 98,622,012 N101Y probably damaging Het
Idh2 G A 7: 80,098,218 P245S probably damaging Het
Irx3 A G 8: 91,798,902 probably benign Het
Lilra5 A T 7: 4,241,932 D234V probably benign Het
Lrfn5 G A 12: 61,839,690 S88N probably damaging Het
Lrp2 A T 2: 69,513,377 S879R possibly damaging Het
Lsm11 A G 11: 45,933,954 S249P probably benign Het
Ltbp1 C T 17: 75,227,192 A543V possibly damaging Het
Mbd1 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,574 Het
Mier2 C T 10: 79,541,156 probably benign Het
Mup6 G C 4: 60,004,093 G70A probably benign Het
Neb A G 2: 52,195,720 L5258P probably damaging Het
Nlrc5 G A 8: 94,521,229 probably benign Het
Nr6a1 A T 2: 38,740,585 F207I possibly damaging Het
Olfr1385 A T 11: 49,494,805 T91S probably benign Het
Olfr181 A T 16: 58,926,504 D22E probably benign Het
Olfr902 T C 9: 38,449,435 C188R probably damaging Het
Osbp2 A G 11: 3,715,191 V51A possibly damaging Het
Papln G T 12: 83,774,949 C317F probably damaging Het
Pdcd7 T C 9: 65,358,622 S454P probably damaging Het
Pde4a C T 9: 21,205,301 T473I probably damaging Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Peg3 G T 7: 6,711,386 S279* probably null Het
Rbl1 A G 2: 157,152,967 Y929H probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall3 C A 18: 80,974,375 E113* probably null Het
Scn5a A C 9: 119,530,023 F653V probably damaging Het
Selenok T A 14: 29,970,048 N14K possibly damaging Het
Slc22a20 T C 19: 5,971,810 T426A probably benign Het
Slc4a2 T A 5: 24,435,009 S563T probably damaging Het
Sspo T A 6: 48,487,955 S3798T probably benign Het
Stag3 G T 5: 138,304,707 R63L possibly damaging Het
Stard9 A T 2: 120,705,186 M3975L probably benign Het
Syne2 C A 12: 75,909,266 T582K probably damaging Het
Synj1 G A 16: 90,963,880 Q748* probably null Het
Tas2r109 T C 6: 132,980,085 D294G probably benign Het
Tbl1xr1 C T 3: 22,191,439 T203M possibly damaging Het
Tbl1xr1 T A 3: 22,191,539 probably null Het
Tcf7l2 A G 19: 55,742,523 D19G probably damaging Het
Tecta A G 9: 42,337,337 V1923A possibly damaging Het
Tg T A 15: 66,688,891 M1034K probably benign Het
Ttf2 T C 3: 100,969,625 E8G possibly damaging Het
Vps13b T A 15: 35,576,395 V983E probably damaging Het
Vwa2 T C 19: 56,901,593 V210A probably benign Het
Xkr6 T A 14: 63,819,644 Y335N probably benign Het
Zfp97 A G 17: 17,145,175 H312R probably damaging Het
Other mutations in Cep192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cep192 APN 18 67820336 missense probably damaging 1.00
IGL00163:Cep192 APN 18 67880800 missense possibly damaging 0.61
IGL00509:Cep192 APN 18 67858868 missense possibly damaging 0.78
IGL01012:Cep192 APN 18 67812406 missense possibly damaging 0.95
IGL01143:Cep192 APN 18 67804375 missense probably damaging 0.97
IGL01302:Cep192 APN 18 67858903 missense probably benign 0.03
IGL01653:Cep192 APN 18 67852972 missense possibly damaging 0.57
IGL02202:Cep192 APN 18 67803137 missense possibly damaging 0.83
IGL02448:Cep192 APN 18 67869447 missense probably benign 0.25
IGL02494:Cep192 APN 18 67804383 missense probably benign 0.00
IGL02574:Cep192 APN 18 67841279 missense probably damaging 0.99
IGL02624:Cep192 APN 18 67880795 missense probably benign 0.20
IGL02646:Cep192 APN 18 67862477 missense probably damaging 1.00
IGL02652:Cep192 APN 18 67858850 splice site probably benign
IGL02684:Cep192 APN 18 67834563 missense probably damaging 0.99
IGL02977:Cep192 APN 18 67852905 missense probably damaging 0.97
IGL03000:Cep192 APN 18 67852044 missense probably damaging 1.00
IGL03133:Cep192 APN 18 67810105 missense probably benign 0.00
IGL03139:Cep192 APN 18 67828476 critical splice donor site probably null
IGL03213:Cep192 APN 18 67865637 missense probably damaging 1.00
IGL03250:Cep192 APN 18 67807355 missense probably benign 0.01
IGL03259:Cep192 APN 18 67820412 missense probably damaging 1.00
R0117:Cep192 UTSW 18 67850737 critical splice donor site probably null
R0180:Cep192 UTSW 18 67835488 missense probably damaging 1.00
R0281:Cep192 UTSW 18 67828482 splice site probably benign
R0374:Cep192 UTSW 18 67818883 nonsense probably null
R0420:Cep192 UTSW 18 67813893 missense possibly damaging 0.91
R0479:Cep192 UTSW 18 67858018 missense probably damaging 1.00
R0652:Cep192 UTSW 18 67807265 missense probably benign 0.04
R1024:Cep192 UTSW 18 67838054 missense probably benign 0.37
R1382:Cep192 UTSW 18 67856299 missense possibly damaging 0.74
R1394:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1395:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1641:Cep192 UTSW 18 67847433 missense probably damaging 1.00
R1704:Cep192 UTSW 18 67856256 missense probably damaging 1.00
R1793:Cep192 UTSW 18 67851767 missense possibly damaging 0.74
R1835:Cep192 UTSW 18 67804424 missense possibly damaging 0.95
R1978:Cep192 UTSW 18 67803158 critical splice donor site probably null
R2164:Cep192 UTSW 18 67820360 missense probably damaging 0.99
R2180:Cep192 UTSW 18 67824742 missense possibly damaging 0.82
R2307:Cep192 UTSW 18 67813899 missense probably benign 0.07
R2442:Cep192 UTSW 18 67824688 missense possibly damaging 0.89
R2897:Cep192 UTSW 18 67855270 splice site probably null
R2898:Cep192 UTSW 18 67855270 splice site probably null
R2901:Cep192 UTSW 18 67869441 missense possibly damaging 0.94
R3433:Cep192 UTSW 18 67834892 missense probably benign 0.08
R3620:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3621:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3712:Cep192 UTSW 18 67820329 missense probably benign 0.00
R4559:Cep192 UTSW 18 67871513 missense probably damaging 1.00
R4590:Cep192 UTSW 18 67816791 nonsense probably null
R4591:Cep192 UTSW 18 67834968 missense probably damaging 0.99
R4604:Cep192 UTSW 18 67815922 missense possibly damaging 0.64
R4627:Cep192 UTSW 18 67812369 missense probably benign 0.03
R4725:Cep192 UTSW 18 67816766 missense probably benign
R4738:Cep192 UTSW 18 67884830 nonsense probably null
R4739:Cep192 UTSW 18 67851732 missense probably benign 0.02
R4927:Cep192 UTSW 18 67835124 missense probably benign 0.16
R4948:Cep192 UTSW 18 67816804 missense probably benign 0.00
R5090:Cep192 UTSW 18 67860546 missense possibly damaging 0.60
R5105:Cep192 UTSW 18 67866541 missense probably benign 0.08
R5154:Cep192 UTSW 18 67850684 missense probably damaging 1.00
R5192:Cep192 UTSW 18 67835004 missense probably benign 0.03
R5735:Cep192 UTSW 18 67880795 missense probably benign 0.20
R5812:Cep192 UTSW 18 67851737 missense possibly damaging 0.49
R5869:Cep192 UTSW 18 67815864 missense probably benign 0.01
R5981:Cep192 UTSW 18 67860590 missense probably damaging 1.00
R6131:Cep192 UTSW 18 67837997 missense possibly damaging 0.65
R6335:Cep192 UTSW 18 67834713 missense probably damaging 1.00
R6849:Cep192 UTSW 18 67812435 missense probably benign 0.00
R7192:Cep192 UTSW 18 67850528 missense probably damaging 0.99
R7264:Cep192 UTSW 18 67820355 missense probably damaging 1.00
R7397:Cep192 UTSW 18 67856197 missense probably damaging 1.00
R7409:Cep192 UTSW 18 67834803 missense possibly damaging 0.76
R7696:Cep192 UTSW 18 67820363 missense probably damaging 1.00
R7756:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
R7758:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
R8247:Cep192 UTSW 18 67841117 missense probably benign 0.02
R8695:Cep192 UTSW 18 67818887 nonsense probably null
R8865:Cep192 UTSW 18 67834632 missense probably benign 0.01
R8935:Cep192 UTSW 18 67862472 missense probably damaging 1.00
R9453:Cep192 UTSW 18 67856283 nonsense probably null
RF003:Cep192 UTSW 18 67837956 missense probably benign 0.44
X0066:Cep192 UTSW 18 67812449 splice site probably null
Z1176:Cep192 UTSW 18 67881288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCAGCCAGGTTCCTAATC -3'
(R):5'- GCTCAGTTTCACAGTTTGTAACC -3'

Sequencing Primer
(F):5'- TAATCCGGGTGCCTCTGGAAC -3'
(R):5'- CATAGGAAATGGCTTTGCTGTAC -3'
Posted On 2018-09-12