Incidental Mutation 'R6850:Trim45'
ID535583
Institutional Source Beutler Lab
Gene Symbol Trim45
Ensembl Gene ENSMUSG00000033233
Gene Nametripartite motif-containing 45
Synonyms4921530N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6850 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location100922202-100936920 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 100923225 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 105 (L105*)
Ref Sequence ENSEMBL: ENSMUSP00000115669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037409] [ENSMUST00000094048] [ENSMUST00000106980] [ENSMUST00000134993]
Predicted Effect probably null
Transcript: ENSMUST00000037409
AA Change: L105*
SMART Domains Protein: ENSMUSP00000043389
Gene: ENSMUSG00000033233
AA Change: L105*

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000094048
AA Change: L56*
SMART Domains Protein: ENSMUSP00000091590
Gene: ENSMUSG00000033233
AA Change: L56*

DomainStartEndE-ValueType
BBOX 81 127 1.03e-1 SMART
BBOX 137 178 4.34e-5 SMART
BBC 185 311 3.55e-9 SMART
IG_FLMN 349 451 7.63e-33 SMART
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106980
AA Change: L105*
SMART Domains Protein: ENSMUSP00000102593
Gene: ENSMUSG00000033233
AA Change: L105*

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134993
AA Change: L105*
SMART Domains Protein: ENSMUSP00000115669
Gene: ENSMUSG00000033233
AA Change: L105*

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif family. The encoded protein may function as a transcriptional repressor of the mitogen-activated protein kinase pathway. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
4932415D10Rik A C 10: 82,293,054 M1374R possibly damaging Het
Adgb T C 10: 10,394,574 M927V probably benign Het
Agr2 A G 12: 35,995,559 I15V probably benign Het
Alpk1 A G 3: 127,729,363 I10T possibly damaging Het
Art5 A G 7: 102,098,095 V159A possibly damaging Het
Asz1 G A 6: 18,108,943 R32W probably benign Het
Atp8b1 A C 18: 64,556,852 M603R possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Car9 A G 4: 43,507,321 E3G probably damaging Het
Cpne3 A T 4: 19,535,231 I267N possibly damaging Het
Cyp2c65 T A 19: 39,069,091 F57I probably benign Het
D430041D05Rik T C 2: 104,201,259 K980R probably damaging Het
Dnhd1 G T 7: 105,719,930 G4303W possibly damaging Het
Dnmt3a A G 12: 3,897,600 N485D probably benign Het
Dusp4 A T 8: 34,816,497 K166* probably null Het
Ect2 T C 3: 27,138,885 D344G probably damaging Het
Eif2b1 T C 5: 124,579,006 D3G probably benign Het
Ermp1 A G 19: 29,616,641 Y710H probably damaging Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm16486 A T 8: 70,710,776 N873Y probably damaging Het
Gm35339 A G 15: 76,357,796 Y763C probably damaging Het
H2-T10 A G 17: 36,119,260 L263P probably damaging Het
Itga7 A T 10: 128,945,516 I621F probably damaging Het
Kcna3 A T 3: 107,037,159 D246V probably damaging Het
Kctd12 C T 14: 102,981,978 G155S probably benign Het
Lrtm1 T C 14: 29,027,450 V256A probably benign Het
Mcf2l T C 8: 13,009,476 F629L possibly damaging Het
Mphosph9 A G 5: 124,260,956 F999L probably damaging Het
Obscn C T 11: 59,002,129 A6764T possibly damaging Het
Obscn C T 11: 59,068,124 V3643M possibly damaging Het
Olfr1189 T A 2: 88,592,306 C167* probably null Het
Olfr1537 T C 9: 39,237,975 I150V probably benign Het
Pdhx T C 2: 103,041,100 H195R probably damaging Het
Pdilt A T 7: 119,486,959 V511E probably damaging Het
Prima1 C T 12: 103,197,335 D126N probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prune2 C A 19: 17,122,188 D1685E probably benign Het
Ptgs2 A T 1: 150,105,540 I525F probably damaging Het
Rab11fip2 A T 19: 59,937,009 F259I possibly damaging Het
Ranbp3l C A 15: 9,058,727 D216E probably damaging Het
Scn5a A T 9: 119,501,749 L1240Q possibly damaging Het
Sohlh2 A T 3: 55,192,286 T160S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tank A G 2: 61,650,002 E294G probably benign Het
Tars T A 15: 11,392,799 Y187F probably benign Het
Tas2r144 T A 6: 42,215,923 M199K possibly damaging Het
Tdrd3 T C 14: 87,458,079 probably benign Het
Tecta T A 9: 42,343,838 D1683V probably benign Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tmie A G 9: 110,866,912 I137T possibly damaging Het
Trpv3 G A 11: 73,291,693 G568S probably damaging Het
Wdr75 A G 1: 45,814,598 T390A probably benign Het
Zfp35 G A 18: 24,002,782 R61H possibly damaging Het
Other mutations in Trim45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Trim45 APN 3 100931726 intron probably benign
IGL01472:Trim45 APN 3 100928065 missense probably benign 0.00
IGL01996:Trim45 APN 3 100928109 nonsense probably null 0.00
IGL02392:Trim45 APN 3 100925305 missense probably benign 0.04
IGL03229:Trim45 APN 3 100923069 missense probably damaging 1.00
IGL02837:Trim45 UTSW 3 100931627 intron probably benign
R0021:Trim45 UTSW 3 100925420 missense probably damaging 1.00
R0243:Trim45 UTSW 3 100929844 missense probably benign 0.05
R0501:Trim45 UTSW 3 100923219 missense probably damaging 1.00
R1222:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1418:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1813:Trim45 UTSW 3 100922967 missense probably benign 0.16
R2148:Trim45 UTSW 3 100932044 nonsense probably null
R2383:Trim45 UTSW 3 100925227 missense probably damaging 0.97
R4368:Trim45 UTSW 3 100923186 missense probably damaging 1.00
R4769:Trim45 UTSW 3 100931734 intron probably benign
R4840:Trim45 UTSW 3 100925488 missense possibly damaging 0.95
R5030:Trim45 UTSW 3 100928072 missense probably damaging 1.00
R5272:Trim45 UTSW 3 100929919 missense probably damaging 1.00
R5298:Trim45 UTSW 3 100925471 missense probably damaging 1.00
R5498:Trim45 UTSW 3 100925141 missense possibly damaging 0.67
R5589:Trim45 UTSW 3 100929941 missense probably damaging 1.00
R6537:Trim45 UTSW 3 100925396 missense probably benign 0.39
R7009:Trim45 UTSW 3 100931879 intron probably benign
R7122:Trim45 UTSW 3 100932037 missense unknown
R7583:Trim45 UTSW 3 100925023 missense probably damaging 1.00
X0066:Trim45 UTSW 3 100931767 intron probably benign
Z1088:Trim45 UTSW 3 100925640 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTGCCTTGCTTGCACACAG -3'
(R):5'- CTTACGCCACAATAAACGGG -3'

Sequencing Primer
(F):5'- GTGTGCACCACGTGTCTG -3'
(R):5'- TCTTTACCTATGAGCCTGGCAG -3'
Posted On2018-09-12