Incidental Mutation 'R6850:Kcna3'
ID535584
Institutional Source Beutler Lab
Gene Symbol Kcna3
Ensembl Gene ENSMUSG00000047959
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 3
SynonymsKv1.3, Mk-3, Kca1-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R6850 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107036169-107038070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107037159 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 246 (D246V)
Ref Sequence ENSEMBL: ENSMUSP00000050680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052718]
Predicted Effect probably damaging
Transcript: ENSMUST00000052718
AA Change: D246V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050680
Gene: ENSMUSG00000047959
AA Change: D246V

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
BTB 57 157 6.9e-10 SMART
Pfam:Ion_trans 186 444 4.2e-54 PFAM
Pfam:Ion_trans_2 352 437 2.3e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display no apparent immune system defects. Mice homozygous for a different knock-out allele show reduced body weight, increased basal metabolic rate, resistance to diet-induced obesity, increased insulin sensitivity, and altered peripheral glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
4932415D10Rik A C 10: 82,293,054 M1374R possibly damaging Het
Adgb T C 10: 10,394,574 M927V probably benign Het
Agr2 A G 12: 35,995,559 I15V probably benign Het
Alpk1 A G 3: 127,729,363 I10T possibly damaging Het
Art5 A G 7: 102,098,095 V159A possibly damaging Het
Asz1 G A 6: 18,108,943 R32W probably benign Het
Atp8b1 A C 18: 64,556,852 M603R possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Car9 A G 4: 43,507,321 E3G probably damaging Het
Cpne3 A T 4: 19,535,231 I267N possibly damaging Het
Cyp2c65 T A 19: 39,069,091 F57I probably benign Het
D430041D05Rik T C 2: 104,201,259 K980R probably damaging Het
Dnhd1 G T 7: 105,719,930 G4303W possibly damaging Het
Dnmt3a A G 12: 3,897,600 N485D probably benign Het
Dusp4 A T 8: 34,816,497 K166* probably null Het
Ect2 T C 3: 27,138,885 D344G probably damaging Het
Eif2b1 T C 5: 124,579,006 D3G probably benign Het
Ermp1 A G 19: 29,616,641 Y710H probably damaging Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm16486 A T 8: 70,710,776 N873Y probably damaging Het
Gm35339 A G 15: 76,357,796 Y763C probably damaging Het
H2-T10 A G 17: 36,119,260 L263P probably damaging Het
Itga7 A T 10: 128,945,516 I621F probably damaging Het
Kctd12 C T 14: 102,981,978 G155S probably benign Het
Lrtm1 T C 14: 29,027,450 V256A probably benign Het
Mcf2l T C 8: 13,009,476 F629L possibly damaging Het
Mphosph9 A G 5: 124,260,956 F999L probably damaging Het
Obscn C T 11: 59,002,129 A6764T possibly damaging Het
Obscn C T 11: 59,068,124 V3643M possibly damaging Het
Olfr1189 T A 2: 88,592,306 C167* probably null Het
Olfr1537 T C 9: 39,237,975 I150V probably benign Het
Pdhx T C 2: 103,041,100 H195R probably damaging Het
Pdilt A T 7: 119,486,959 V511E probably damaging Het
Prima1 C T 12: 103,197,335 D126N probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prune2 C A 19: 17,122,188 D1685E probably benign Het
Ptgs2 A T 1: 150,105,540 I525F probably damaging Het
Rab11fip2 A T 19: 59,937,009 F259I possibly damaging Het
Ranbp3l C A 15: 9,058,727 D216E probably damaging Het
Scn5a A T 9: 119,501,749 L1240Q possibly damaging Het
Sohlh2 A T 3: 55,192,286 T160S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tank A G 2: 61,650,002 E294G probably benign Het
Tars T A 15: 11,392,799 Y187F probably benign Het
Tas2r144 T A 6: 42,215,923 M199K possibly damaging Het
Tdrd3 T C 14: 87,458,079 probably benign Het
Tecta T A 9: 42,343,838 D1683V probably benign Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tmie A G 9: 110,866,912 I137T possibly damaging Het
Trim45 T A 3: 100,923,225 L105* probably null Het
Trpv3 G A 11: 73,291,693 G568S probably damaging Het
Wdr75 A G 1: 45,814,598 T390A probably benign Het
Zfp35 G A 18: 24,002,782 R61H possibly damaging Het
Other mutations in Kcna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Kcna3 APN 3 107037156 missense probably benign 0.33
IGL00562:Kcna3 APN 3 107036730 missense probably damaging 1.00
IGL01106:Kcna3 APN 3 107037864 missense possibly damaging 0.89
IGL01318:Kcna3 APN 3 107037978 missense probably benign 0.03
IGL02253:Kcna3 APN 3 107037411 missense probably damaging 1.00
IGL03379:Kcna3 APN 3 107037205 missense probably benign 0.05
IGL02802:Kcna3 UTSW 3 107037053 missense probably damaging 0.99
IGL03014:Kcna3 UTSW 3 107037890 missense probably benign 0.00
R0393:Kcna3 UTSW 3 107036999 missense probably damaging 1.00
R1591:Kcna3 UTSW 3 107037029 missense probably damaging 1.00
R1922:Kcna3 UTSW 3 107037935 missense possibly damaging 0.47
R1950:Kcna3 UTSW 3 107037672 missense probably damaging 1.00
R3847:Kcna3 UTSW 3 107036696 missense possibly damaging 0.57
R4912:Kcna3 UTSW 3 107037891 missense probably benign
R6261:Kcna3 UTSW 3 107037950 missense possibly damaging 0.53
R6271:Kcna3 UTSW 3 107037606 missense probably damaging 1.00
R6334:Kcna3 UTSW 3 107036424 start codon destroyed probably null
R6423:Kcna3 UTSW 3 107036842 nonsense probably null
R6901:Kcna3 UTSW 3 107036568 missense probably benign 0.00
R7193:Kcna3 UTSW 3 107036537 missense probably benign 0.02
R7524:Kcna3 UTSW 3 107037207 missense probably damaging 1.00
Z1088:Kcna3 UTSW 3 107036953 missense probably damaging 1.00
Z1176:Kcna3 UTSW 3 107037266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGCTCTTCGAATATCCG -3'
(R):5'- CATTACCTTGTCGTTCAGCCAG -3'

Sequencing Primer
(F):5'- TTCGAATATCCGGAGAGCTCC -3'
(R):5'- TGTCGTTCAGCCAGCTCAGTG -3'
Posted On2018-09-12