Mutagenetix > Incidental Mutations

Incidental Mutation 'R6850:Mphosph9'

535589

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6850 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124260956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 999 (F999L)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000031344
AA Change: F969L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: F969L

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

probably damaging
Transcript: ENSMUST00000184951
AA Change: F999L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: F999L

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	ACTGCACCACCT	ACT	10: 43,532,725		probably benign	Het
4932415D10Rik	A	C	10: 82,293,054	M1374R	possibly damaging	Het
Adgb	T	C	10: 10,394,574	M927V	probably benign	Het
Agr2	A	G	12: 35,995,559	I15V	probably benign	Het
Alpk1	A	G	3: 127,729,363	I10T	possibly damaging	Het
Art5	A	G	7: 102,098,095	V159A	possibly damaging	Het
Asz1	G	A	6: 18,108,943	R32W	probably benign	Het
Atp8b1	A	C	18: 64,556,852	M603R	possibly damaging	Het
Cacna1s	G	A	1: 136,092,694	R823Q	probably benign	Het
Car9	A	G	4: 43,507,321	E3G	probably damaging	Het
Cpne3	A	T	4: 19,535,231	I267N	possibly damaging	Het
Cyp2c65	T	A	19: 39,069,091	F57I	probably benign	Het
D430041D05Rik	T	C	2: 104,201,259	K980R	probably damaging	Het
Dnhd1	G	T	7: 105,719,930	G4303W	possibly damaging	Het
Dnmt3a	A	G	12: 3,897,600	N485D	probably benign	Het
Dusp4	A	T	8: 34,816,497	K166*	probably null	Het
Ect2	T	C	3: 27,138,885	D344G	probably damaging	Het
Eif2b1	T	C	5: 124,579,006	D3G	probably benign	Het
Ermp1	A	G	19: 29,616,641	Y710H	probably damaging	Het
Gar1	T	C	3: 129,829,389	N117S	probably damaging	Het
Gm16486	A	T	8: 70,710,776	N873Y	probably damaging	Het
Gm35339	A	G	15: 76,357,796	Y763C	probably damaging	Het
H2-T10	A	G	17: 36,119,260	L263P	probably damaging	Het
Itga7	A	T	10: 128,945,516	I621F	probably damaging	Het
Kcna3	A	T	3: 107,037,159	D246V	probably damaging	Het
Kctd12	C	T	14: 102,981,978	G155S	probably benign	Het
Lrtm1	T	C	14: 29,027,450	V256A	probably benign	Het
Mcf2l	T	C	8: 13,009,476	F629L	possibly damaging	Het
Obscn	C	T	11: 59,002,129	A6764T	possibly damaging	Het
Obscn	C	T	11: 59,068,124	V3643M	possibly damaging	Het
Olfr1189	T	A	2: 88,592,306	C167*	probably null	Het
Olfr1537	T	C	9: 39,237,975	I150V	probably benign	Het
Pdhx	T	C	2: 103,041,100	H195R	probably damaging	Het
Pdilt	A	T	7: 119,486,959	V511E	probably damaging	Het
Prima1	C	T	12: 103,197,335	D126N	probably benign	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Prune2	C	A	19: 17,122,188	D1685E	probably benign	Het
Ptgs2	A	T	1: 150,105,540	I525F	probably damaging	Het
Rab11fip2	A	T	19: 59,937,009	F259I	possibly damaging	Het
Ranbp3l	C	A	15: 9,058,727	D216E	probably damaging	Het
Scn5a	A	T	9: 119,501,749	L1240Q	possibly damaging	Het
Sohlh2	A	T	3: 55,192,286	T160S	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Tank	A	G	2: 61,650,002	E294G	probably benign	Het
Tars	T	A	15: 11,392,799	Y187F	probably benign	Het
Tas2r144	T	A	6: 42,215,923	M199K	possibly damaging	Het
Tdrd3	T	C	14: 87,458,079		probably benign	Het
Tecta	T	A	9: 42,343,838	D1683V	probably benign	Het
Tln2	A	G	9: 67,258,535	I2098T	probably damaging	Het
Tmie	A	G	9: 110,866,912	I137T	possibly damaging	Het
Trim45	T	A	3: 100,923,225	L105*	probably null	Het
Trpv3	G	A	11: 73,291,693	G568S	probably damaging	Het
Wdr75	A	G	1: 45,814,598	T390A	probably benign	Het
Zfp35	G	A	18: 24,002,782	R61H	possibly damaging	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGGGGAGCTGTATAGAACTGTCTG -3'
(R):5'- TTCCGTGCCAGCTTTGTCAG -3'

Sequencing Primer
(F):5'- ATAGAACTGTCTGGTGGTGACAATC -3'
(R):5'- AACCATGTGACTGTGAGCTC -3'

Posted On

2018-09-12