Mutagenetix > Incidental Mutations

Incidental Mutation 'R6850:Tecta'

535600

Institutional Source

Beutler Lab

Gene Symbol

Tecta

Ensembl Gene

ENSMUSG00000037705

Gene Name

tectorin alpha

Synonyms

[a]-tectorin, Tctna

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R6850 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42329619-42399929 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42343838 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1683 (D1683V)

Ref Sequence

ENSEMBL: ENSMUSP00000125370 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]

Predicted Effect

probably benign
Transcript: ENSMUST00000042190
AA Change: D1688V

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: D1688V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	9.8e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1684	1758	6.51e-10	SMART
ZP	1805	2059	2.95e-85	SMART
EGF	2087	2122	2.07e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160940
AA Change: D1683V

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: D1683V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	6.1e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1679	1753	6.51e-10	SMART
ZP	1800	2054	2.95e-85	SMART
EGF	2082	2117	2.07e1	SMART

Meta Mutation Damage Score

0.2815

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	ACTGCACCACCT	ACT	10: 43,532,725		probably benign	Het
4932415D10Rik	A	C	10: 82,293,054	M1374R	possibly damaging	Het
Adgb	T	C	10: 10,394,574	M927V	probably benign	Het
Agr2	A	G	12: 35,995,559	I15V	probably benign	Het
Alpk1	A	G	3: 127,729,363	I10T	possibly damaging	Het
Art5	A	G	7: 102,098,095	V159A	possibly damaging	Het
Asz1	G	A	6: 18,108,943	R32W	probably benign	Het
Atp8b1	A	C	18: 64,556,852	M603R	possibly damaging	Het
Cacna1s	G	A	1: 136,092,694	R823Q	probably benign	Het
Car9	A	G	4: 43,507,321	E3G	probably damaging	Het
Cpne3	A	T	4: 19,535,231	I267N	possibly damaging	Het
Cyp2c65	T	A	19: 39,069,091	F57I	probably benign	Het
D430041D05Rik	T	C	2: 104,201,259	K980R	probably damaging	Het
Dnhd1	G	T	7: 105,719,930	G4303W	possibly damaging	Het
Dnmt3a	A	G	12: 3,897,600	N485D	probably benign	Het
Dusp4	A	T	8: 34,816,497	K166*	probably null	Het
Ect2	T	C	3: 27,138,885	D344G	probably damaging	Het
Eif2b1	T	C	5: 124,579,006	D3G	probably benign	Het
Ermp1	A	G	19: 29,616,641	Y710H	probably damaging	Het
Gar1	T	C	3: 129,829,389	N117S	probably damaging	Het
Gm16486	A	T	8: 70,710,776	N873Y	probably damaging	Het
Gm35339	A	G	15: 76,357,796	Y763C	probably damaging	Het
H2-T10	A	G	17: 36,119,260	L263P	probably damaging	Het
Itga7	A	T	10: 128,945,516	I621F	probably damaging	Het
Kcna3	A	T	3: 107,037,159	D246V	probably damaging	Het
Kctd12	C	T	14: 102,981,978	G155S	probably benign	Het
Lrtm1	T	C	14: 29,027,450	V256A	probably benign	Het
Mcf2l	T	C	8: 13,009,476	F629L	possibly damaging	Het
Mphosph9	A	G	5: 124,260,956	F999L	probably damaging	Het
Obscn	C	T	11: 59,002,129	A6764T	possibly damaging	Het
Obscn	C	T	11: 59,068,124	V3643M	possibly damaging	Het
Olfr1189	T	A	2: 88,592,306	C167*	probably null	Het
Olfr1537	T	C	9: 39,237,975	I150V	probably benign	Het
Pdhx	T	C	2: 103,041,100	H195R	probably damaging	Het
Pdilt	A	T	7: 119,486,959	V511E	probably damaging	Het
Prima1	C	T	12: 103,197,335	D126N	probably benign	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Prune2	C	A	19: 17,122,188	D1685E	probably benign	Het
Ptgs2	A	T	1: 150,105,540	I525F	probably damaging	Het
Rab11fip2	A	T	19: 59,937,009	F259I	possibly damaging	Het
Ranbp3l	C	A	15: 9,058,727	D216E	probably damaging	Het
Scn5a	A	T	9: 119,501,749	L1240Q	possibly damaging	Het
Sohlh2	A	T	3: 55,192,286	T160S	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Tank	A	G	2: 61,650,002	E294G	probably benign	Het
Tars	T	A	15: 11,392,799	Y187F	probably benign	Het
Tas2r144	T	A	6: 42,215,923	M199K	possibly damaging	Het
Tdrd3	T	C	14: 87,458,079		probably benign	Het
Tln2	A	G	9: 67,258,535	I2098T	probably damaging	Het
Tmie	A	G	9: 110,866,912	I137T	possibly damaging	Het
Trim45	T	A	3: 100,923,225	L105*	probably null	Het
Trpv3	G	A	11: 73,291,693	G568S	probably damaging	Het
Wdr75	A	G	1: 45,814,598	T390A	probably benign	Het
Zfp35	G	A	18: 24,002,782	R61H	possibly damaging	Het

Other mutations in Tecta

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Tecta	APN	9	42332548	missense	probably damaging	1.00
IGL00925:Tecta	APN	9	42375035	missense	probably benign
IGL00960:Tecta	APN	9	42359080	missense	possibly damaging	0.74
IGL00974:Tecta	APN	9	42331374	missense	probably benign	0.00
IGL01070:Tecta	APN	9	42395003	missense	probably damaging	1.00
IGL01284:Tecta	APN	9	42345620	missense	probably damaging	1.00
IGL01324:Tecta	APN	9	42345431	missense	probably damaging	1.00
IGL01694:Tecta	APN	9	42367179	missense	possibly damaging	0.92
IGL01861:Tecta	APN	9	42373362	missense	probably benign
IGL02010:Tecta	APN	9	42337193	missense	probably damaging	0.97
IGL02397:Tecta	APN	9	42394998	missense	probably damaging	1.00
IGL03031:Tecta	APN	9	42345493	missense	probably benign
IGL03208:Tecta	APN	9	42337100	splice site	probably benign
IGL03249:Tecta	APN	9	42391886	missense	probably benign	0.20
R0004:Tecta	UTSW	9	42345478	missense	possibly damaging	0.74
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0119:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0133:Tecta	UTSW	9	42367228	missense	probably benign	0.00
R0157:Tecta	UTSW	9	42375011	missense	probably benign
R0180:Tecta	UTSW	9	42366813	missense	probably benign
R0299:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0345:Tecta	UTSW	9	42384218	missense	probably damaging	0.98
R0370:Tecta	UTSW	9	42366804	missense	probably benign
R0465:Tecta	UTSW	9	42359418	missense	possibly damaging	0.62
R0466:Tecta	UTSW	9	42373073	missense	probably benign
R0479:Tecta	UTSW	9	42337939	missense	probably damaging	1.00
R0498:Tecta	UTSW	9	42377614	missense	probably damaging	1.00
R0499:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0519:Tecta	UTSW	9	42347892	splice site	probably benign
R0584:Tecta	UTSW	9	42347908	missense	possibly damaging	0.79
R0589:Tecta	UTSW	9	42345634	missense	probably benign	0.01
R0607:Tecta	UTSW	9	42388205	missense	probably damaging	1.00
R0691:Tecta	UTSW	9	42384341	missense	probably damaging	1.00
R0905:Tecta	UTSW	9	42338994	missense	probably damaging	1.00
R1216:Tecta	UTSW	9	42377907	missense	probably benign	0.44
R1239:Tecta	UTSW	9	42332485	missense	probably damaging	1.00
R1442:Tecta	UTSW	9	42332482	missense	probably damaging	1.00
R1553:Tecta	UTSW	9	42348186	missense	probably damaging	1.00
R1727:Tecta	UTSW	9	42359301	missense	probably damaging	0.96
R1728:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1729:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1762:Tecta	UTSW	9	42375309	missense	probably benign	0.30
R1778:Tecta	UTSW	9	42343631	missense	probably damaging	1.00
R1795:Tecta	UTSW	9	42378049	missense	probably benign
R1796:Tecta	UTSW	9	42384197	missense	probably damaging	1.00
R1866:Tecta	UTSW	9	42392024	missense	probably damaging	0.97
R1871:Tecta	UTSW	9	42337176	missense	probably damaging	0.98
R1871:Tecta	UTSW	9	42337340	missense	probably damaging	1.00
R1911:Tecta	UTSW	9	42337936	missense	probably damaging	1.00
R2074:Tecta	UTSW	9	42337279	nonsense	probably null
R2135:Tecta	UTSW	9	42340285	missense	probably damaging	1.00
R2171:Tecta	UTSW	9	42358924	missense	probably damaging	0.99
R2220:Tecta	UTSW	9	42392030	missense	probably damaging	1.00
R2372:Tecta	UTSW	9	42388274	missense	probably damaging	1.00
R2570:Tecta	UTSW	9	42332552	missense	probably damaging	1.00
R2939:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R2940:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3081:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3407:Tecta	UTSW	9	42337854	missense	probably damaging	1.00
R3732:Tecta	UTSW	9	42392106	missense	possibly damaging	0.95
R3771:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3772:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3773:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3832:Tecta	UTSW	9	42339033	missense	probably damaging	1.00
R4378:Tecta	UTSW	9	42366708	missense	probably damaging	1.00
R4480:Tecta	UTSW	9	42373233	missense	possibly damaging	0.75
R4485:Tecta	UTSW	9	42337274	missense	possibly damaging	0.73
R4804:Tecta	UTSW	9	42398237	missense	probably benign
R4869:Tecta	UTSW	9	42375534	missense	probably benign	0.02
R4944:Tecta	UTSW	9	42330277	missense	probably benign	0.05
R5008:Tecta	UTSW	9	42373062	missense	possibly damaging	0.76
R5014:Tecta	UTSW	9	42373242	missense	probably damaging	1.00
R5125:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5178:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5180:Tecta	UTSW	9	42337208	missense	probably damaging	1.00
R5214:Tecta	UTSW	9	42345668	missense	probably benign	0.04
R5230:Tecta	UTSW	9	42394943	missense	probably damaging	0.96
R5330:Tecta	UTSW	9	42337856	missense	probably damaging	1.00
R5387:Tecta	UTSW	9	42375063	missense	probably damaging	0.98
R5614:Tecta	UTSW	9	42339055	missense	probably damaging	1.00
R5708:Tecta	UTSW	9	42338926	missense	probably damaging	1.00
R5738:Tecta	UTSW	9	42373178	missense	possibly damaging	0.63
R5770:Tecta	UTSW	9	42345589	missense	possibly damaging	0.94
R5839:Tecta	UTSW	9	42331023	missense	probably benign	0.03
R5839:Tecta	UTSW	9	42372976	missense	possibly damaging	0.86
R6119:Tecta	UTSW	9	42373075	missense	probably benign	0.00
R6246:Tecta	UTSW	9	42377908	missense	probably benign	0.07
R6377:Tecta	UTSW	9	42343755	missense	probably damaging	1.00
R6416:Tecta	UTSW	9	42375267	missense	probably damaging	0.97
R6595:Tecta	UTSW	9	42384227	missense	probably damaging	1.00
R6859:Tecta	UTSW	9	42392129	missense	probably damaging	1.00
R6861:Tecta	UTSW	9	42337337	missense	possibly damaging	0.93
R6939:Tecta	UTSW	9	42347997	missense	probably damaging	1.00
R6996:Tecta	UTSW	9	42366786	missense	probably benign
R7069:Tecta	UTSW	9	42394941	missense	probably benign	0.03
R7104:Tecta	UTSW	9	42366943	missense	probably benign	0.00
R7129:Tecta	UTSW	9	42347991	missense	probably damaging	1.00
R7220:Tecta	UTSW	9	42343887	missense	probably benign	0.05
R7251:Tecta	UTSW	9	42387752	missense	probably damaging	1.00
R7307:Tecta	UTSW	9	42377992	missense	probably damaging	1.00
R7343:Tecta	UTSW	9	42337332	missense	probably damaging	1.00
R7355:Tecta	UTSW	9	42367142	nonsense	probably null
R7635:Tecta	UTSW	9	42330987	missense	probably benign	0.11
R7653:Tecta	UTSW	9	42337236	missense	probably damaging	1.00
R7723:Tecta	UTSW	9	42366936	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATCCACTCGGTGCTAAGGATG -3'
(R):5'- AAGGTCACGTTGCTAGGCAG -3'

Sequencing Primer
(F):5'- TCGGTGCTAAGGATGCCGAAG -3'
(R):5'- TCTGCATATTATATAAACTTCAGGGC -3'

Posted On

2018-09-12