Incidental Mutation 'R6850:Agr2'
ID535612
Institutional Source Beutler Lab
Gene Symbol Agr2
Ensembl Gene ENSMUSG00000020581
Gene Nameanterior gradient 2
SynonymsXAG-2, mAG-2, Gob-4, HAG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R6850 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location35992907-36004087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35995559 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 15 (I15V)
Ref Sequence ENSEMBL: ENSMUSP00000020898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020898]
Predicted Effect probably benign
Transcript: ENSMUST00000020898
AA Change: I15V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020898
Gene: ENSMUSG00000020581
AA Change: I15V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin_7 53 133 1.9e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit colitis and increased susceptibility to induced colitis. Mice homozygous for another knock-out allele exhibit hyperplasia and defective lineage maturation in the stomach that leads to intestinal obstruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
4932415D10Rik A C 10: 82,293,054 M1374R possibly damaging Het
Adgb T C 10: 10,394,574 M927V probably benign Het
Alpk1 A G 3: 127,729,363 I10T possibly damaging Het
Art5 A G 7: 102,098,095 V159A possibly damaging Het
Asz1 G A 6: 18,108,943 R32W probably benign Het
Atp8b1 A C 18: 64,556,852 M603R possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Car9 A G 4: 43,507,321 E3G probably damaging Het
Cpne3 A T 4: 19,535,231 I267N possibly damaging Het
Cyp2c65 T A 19: 39,069,091 F57I probably benign Het
D430041D05Rik T C 2: 104,201,259 K980R probably damaging Het
Dnhd1 G T 7: 105,719,930 G4303W possibly damaging Het
Dnmt3a A G 12: 3,897,600 N485D probably benign Het
Dusp4 A T 8: 34,816,497 K166* probably null Het
Ect2 T C 3: 27,138,885 D344G probably damaging Het
Eif2b1 T C 5: 124,579,006 D3G probably benign Het
Ermp1 A G 19: 29,616,641 Y710H probably damaging Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm16486 A T 8: 70,710,776 N873Y probably damaging Het
Gm35339 A G 15: 76,357,796 Y763C probably damaging Het
H2-T10 A G 17: 36,119,260 L263P probably damaging Het
Itga7 A T 10: 128,945,516 I621F probably damaging Het
Kcna3 A T 3: 107,037,159 D246V probably damaging Het
Kctd12 C T 14: 102,981,978 G155S probably benign Het
Lrtm1 T C 14: 29,027,450 V256A probably benign Het
Mcf2l T C 8: 13,009,476 F629L possibly damaging Het
Mphosph9 A G 5: 124,260,956 F999L probably damaging Het
Obscn C T 11: 59,002,129 A6764T possibly damaging Het
Obscn C T 11: 59,068,124 V3643M possibly damaging Het
Olfr1189 T A 2: 88,592,306 C167* probably null Het
Olfr1537 T C 9: 39,237,975 I150V probably benign Het
Pdhx T C 2: 103,041,100 H195R probably damaging Het
Pdilt A T 7: 119,486,959 V511E probably damaging Het
Prima1 C T 12: 103,197,335 D126N probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prune2 C A 19: 17,122,188 D1685E probably benign Het
Ptgs2 A T 1: 150,105,540 I525F probably damaging Het
Rab11fip2 A T 19: 59,937,009 F259I possibly damaging Het
Ranbp3l C A 15: 9,058,727 D216E probably damaging Het
Scn5a A T 9: 119,501,749 L1240Q possibly damaging Het
Sohlh2 A T 3: 55,192,286 T160S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tank A G 2: 61,650,002 E294G probably benign Het
Tars T A 15: 11,392,799 Y187F probably benign Het
Tas2r144 T A 6: 42,215,923 M199K possibly damaging Het
Tdrd3 T C 14: 87,458,079 probably benign Het
Tecta T A 9: 42,343,838 D1683V probably benign Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tmie A G 9: 110,866,912 I137T possibly damaging Het
Trim45 T A 3: 100,923,225 L105* probably null Het
Trpv3 G A 11: 73,291,693 G568S probably damaging Het
Wdr75 A G 1: 45,814,598 T390A probably benign Het
Zfp35 G A 18: 24,002,782 R61H possibly damaging Het
Other mutations in Agr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Agr2 APN 12 35995581 missense possibly damaging 0.63
IGL02081:Agr2 APN 12 35995656 critical splice donor site probably null
IGL03190:Agr2 APN 12 35998635 missense probably damaging 1.00
IGL02835:Agr2 UTSW 12 35995904 missense probably benign 0.23
R5514:Agr2 UTSW 12 35996091 missense probably benign
R5894:Agr2 UTSW 12 35995510 splice site probably benign
R6196:Agr2 UTSW 12 35995592 nonsense probably null
R6584:Agr2 UTSW 12 35995626 missense probably benign
R6585:Agr2 UTSW 12 35995626 missense probably benign
R7384:Agr2 UTSW 12 35995924 missense probably damaging 0.98
R7459:Agr2 UTSW 12 35997453 missense probably benign 0.20
R7533:Agr2 UTSW 12 35996129 critical splice donor site probably null
R7567:Agr2 UTSW 12 35995947 missense probably benign 0.00
R8039:Agr2 UTSW 12 35995559 missense probably benign 0.10
R8118:Agr2 UTSW 12 35996107 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGGGAACTCTTGCATCCTGG -3'
(R):5'- AACCTGCTGAGCCTGGATAATAG -3'

Sequencing Primer
(F):5'- CTCTTGCATCCTGGAGAAAGTGAC -3'
(R):5'- CTGCTGAGCCTGGATAATAGATACTC -3'
Posted On2018-09-12