Incidental Mutation 'R6850:Tdrd3'
ID 535615
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Name tudor domain containing 3
Synonyms 4732418C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R6850 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 87416639-87545504 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 87458079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
AlphaFold Q91W18
Predicted Effect probably benign
Transcript: ENSMUST00000168275
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169504
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000126212
Gene: ENSMUSG00000022019
AA Change: V18A

DomainStartEndE-ValueType
DUF1767 19 77 4.37e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170865
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
4932415D10Rik A C 10: 82,293,054 M1374R possibly damaging Het
Adgb T C 10: 10,394,574 M927V probably benign Het
Agr2 A G 12: 35,995,559 I15V probably benign Het
Alpk1 A G 3: 127,729,363 I10T possibly damaging Het
Art5 A G 7: 102,098,095 V159A possibly damaging Het
Asz1 G A 6: 18,108,943 R32W probably benign Het
Atp8b1 A C 18: 64,556,852 M603R possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Car9 A G 4: 43,507,321 E3G probably damaging Het
Cpne3 A T 4: 19,535,231 I267N possibly damaging Het
Cyp2c65 T A 19: 39,069,091 F57I probably benign Het
D430041D05Rik T C 2: 104,201,259 K980R probably damaging Het
Dnhd1 G T 7: 105,719,930 G4303W possibly damaging Het
Dnmt3a A G 12: 3,897,600 N485D probably benign Het
Dusp4 A T 8: 34,816,497 K166* probably null Het
Ect2 T C 3: 27,138,885 D344G probably damaging Het
Eif2b1 T C 5: 124,579,006 D3G probably benign Het
Ermp1 A G 19: 29,616,641 Y710H probably damaging Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm16486 A T 8: 70,710,776 N873Y probably damaging Het
Gm35339 A G 15: 76,357,796 Y763C probably damaging Het
H2-T10 A G 17: 36,119,260 L263P probably damaging Het
Itga7 A T 10: 128,945,516 I621F probably damaging Het
Kcna3 A T 3: 107,037,159 D246V probably damaging Het
Kctd12 C T 14: 102,981,978 G155S probably benign Het
Lrtm1 T C 14: 29,027,450 V256A probably benign Het
Mcf2l T C 8: 13,009,476 F629L possibly damaging Het
Mphosph9 A G 5: 124,260,956 F999L probably damaging Het
Obscn C T 11: 59,002,129 A6764T possibly damaging Het
Obscn C T 11: 59,068,124 V3643M possibly damaging Het
Olfr1189 T A 2: 88,592,306 C167* probably null Het
Olfr1537 T C 9: 39,237,975 I150V probably benign Het
Pdhx T C 2: 103,041,100 H195R probably damaging Het
Pdilt A T 7: 119,486,959 V511E probably damaging Het
Prima1 C T 12: 103,197,335 D126N probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prune2 C A 19: 17,122,188 D1685E probably benign Het
Ptgs2 A T 1: 150,105,540 I525F probably damaging Het
Rab11fip2 A T 19: 59,937,009 F259I possibly damaging Het
Ranbp3l C A 15: 9,058,727 D216E probably damaging Het
Scn5a A T 9: 119,501,749 L1240Q possibly damaging Het
Sohlh2 A T 3: 55,192,286 T160S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tank A G 2: 61,650,002 E294G probably benign Het
Tars T A 15: 11,392,799 Y187F probably benign Het
Tas2r144 T A 6: 42,215,923 M199K possibly damaging Het
Tecta T A 9: 42,343,838 D1683V probably benign Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tmie A G 9: 110,866,912 I137T possibly damaging Het
Trim45 T A 3: 100,923,225 L105* probably null Het
Trpv3 G A 11: 73,291,693 G568S probably damaging Het
Wdr75 A G 1: 45,814,598 T390A probably benign Het
Zfp35 G A 18: 24,002,782 R61H possibly damaging Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87480774 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2096:Tdrd3 UTSW 14 87506352 nonsense probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87506599 missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87506215 missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6532:Tdrd3 UTSW 14 87505816 missense probably damaging 0.98
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7818:Tdrd3 UTSW 14 87472200 missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8206:Tdrd3 UTSW 14 87511778 missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87472201 nonsense probably null
R8985:Tdrd3 UTSW 14 87506161 missense possibly damaging 0.69
R9081:Tdrd3 UTSW 14 87506281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTTGAGGTTGCTGCAGC -3'
(R):5'- TGCTATGTAACCTACAGCGGTG -3'

Sequencing Primer
(F):5'- GATGCTTGTGACCCGCCATATG -3'
(R):5'- TAACCTACAGCGGTGAGGGC -3'
Posted On 2018-09-12