Incidental Mutation 'R6430:Vmn1r3'
ID535641
Institutional Source Beutler Lab
Gene Symbol Vmn1r3
Ensembl Gene ENSMUSG00000115466
Gene Namevomeronasal 1 receptor 3
SynonymsGm11778
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R6430 (G1)
Quality Score44.0073
Status Validated
Chromosome4
Chromosomal Location3184348-3185358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3184971 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 112 (T112I)
Ref Sequence ENSEMBL: ENSMUSP00000100790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105159]
Predicted Effect probably benign
Transcript: ENSMUST00000105159
AA Change: T112I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100790
Gene: ENSMUSG00000115466
AA Change: T112I

DomainStartEndE-ValueType
Pfam:TAS2R 6 302 1.7e-9 PFAM
Pfam:7tm_1 30 292 5.1e-7 PFAM
Pfam:V1R 34 298 1.2e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,466,797 probably benign Het
Als2cr12 T A 1: 58,678,289 K154N probably damaging Het
Ank1 T A 8: 23,132,109 L1513Q probably damaging Het
Ap2a1 C A 7: 44,903,829 V676L probably benign Het
Arid2 T C 15: 96,363,694 V477A probably benign Het
Auh C A 13: 52,929,410 G17C probably benign Het
B3gnt7 T C 1: 86,306,117 F362L possibly damaging Het
Cd207 C T 6: 83,675,887 R87H probably benign Het
Cdyl A G 13: 35,871,606 K503R possibly damaging Het
Cep350 A G 1: 155,894,673 S1824P probably damaging Het
Cmas T A 6: 142,767,924 M225K probably benign Het
Dhx29 T C 13: 112,944,619 S396P possibly damaging Het
Epg5 T C 18: 77,975,885 S958P probably damaging Het
Espnl T C 1: 91,322,248 L39P possibly damaging Het
Fuk A G 8: 110,884,116 V915A probably benign Het
Gatb A G 3: 85,637,038 N438D probably benign Het
Hspg2 T C 4: 137,539,396 C1932R probably damaging Het
Jmjd1c C T 10: 67,224,160 T662I possibly damaging Het
Kcng4 A G 8: 119,633,050 S196P probably damaging Het
Kcnh7 T G 2: 62,850,532 H237P probably benign Het
Klhl38 T C 15: 58,322,311 T341A probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Man2c1 T C 9: 57,131,233 V59A possibly damaging Het
Nr2c1 A T 10: 94,195,341 H588L possibly damaging Het
Olfr137 T C 17: 38,305,358 I34M probably benign Het
Olfr305 A T 7: 86,363,973 Y121* probably null Het
Osbpl6 A G 2: 76,579,276 E494G probably damaging Het
Per1 T C 11: 69,104,296 L638S probably damaging Het
Plekhn1 T C 4: 156,221,804 E603G probably benign Het
Prss12 A T 3: 123,479,594 S280C probably damaging Het
Pudp A G 18: 50,568,236 I142T probably benign Het
Rabl6 A T 2: 25,584,837 N620K probably damaging Het
Rttn T A 18: 89,021,685 C837S probably null Het
Slc16a7 A G 10: 125,231,018 S251P probably damaging Het
Slc7a10 A G 7: 35,197,658 I195V probably benign Het
Slc9a4 A T 1: 40,600,854 R269* probably null Het
Slco6c1 T A 1: 97,075,974 Q466L probably benign Het
Smc6 A G 12: 11,309,234 N953S probably benign Het
Tex15 T C 8: 33,571,301 V527A probably benign Het
Tln2 T C 9: 67,272,665 Y808C probably damaging Het
Tmem145 T C 7: 25,309,038 L289P possibly damaging Het
Trim3 A G 7: 105,618,005 V389A probably benign Het
Vps11 C A 9: 44,361,550 A28S probably benign Het
Zbtb41 T A 1: 139,447,207 S802T probably benign Het
Zmynd10 A T 9: 107,548,712 K82* probably null Het
Other mutations in Vmn1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03130:Vmn1r3 APN 4 3185214 missense possibly damaging 0.89
PIT4131001:Vmn1r3 UTSW 4 3184691 missense probably damaging 1.00
PIT4131001:Vmn1r3 UTSW 4 3184774 missense probably benign 0.02
PIT4142001:Vmn1r3 UTSW 4 3184691 missense probably damaging 1.00
PIT4142001:Vmn1r3 UTSW 4 3184774 missense probably benign 0.02
R0972:Vmn1r3 UTSW 4 3185125 missense probably damaging 1.00
R1423:Vmn1r3 UTSW 4 3185231 missense probably damaging 1.00
R3902:Vmn1r3 UTSW 4 3185241 missense probably benign 0.41
R4999:Vmn1r3 UTSW 4 3185009 nonsense probably null
R6091:Vmn1r3 UTSW 4 3184684 missense probably damaging 0.97
R6140:Vmn1r3 UTSW 4 3185031 missense probably damaging 0.97
R6188:Vmn1r3 UTSW 4 3185017 missense probably damaging 1.00
R6299:Vmn1r3 UTSW 4 3185098 missense possibly damaging 0.95
R6303:Vmn1r3 UTSW 4 3184975 missense probably damaging 1.00
R6304:Vmn1r3 UTSW 4 3184975 missense probably damaging 1.00
R6317:Vmn1r3 UTSW 4 3184993 missense probably benign 0.39
R6633:Vmn1r3 UTSW 4 3184971 missense probably benign
Z1177:Vmn1r3 UTSW 4 3185304 start codon destroyed probably null 0.60
Predicted Primers PCR Primer
(F):5'- TGCTACACTGTCAGAAGCAAAC -3'
(R):5'- GCCCAAAGACCTGATTATAGAGC -3'

Sequencing Primer
(F):5'- CTGTCAGAAGCAAACAATGAGC -3'
(R):5'- GATTATAGAGCACTTGACTTTCGCC -3'
Posted On2018-09-21